Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R05D3.4   

sjj_R05D3.4 RNAi JA:R05D3.4
Simmer:R05D3.4
PF:GL1_7D1
PCR_productsjj_R05D3.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS R05D3.4a Source_evidenceePCR944WS150 Sequence/Annotation Release
R05D3.4b Source_evidenceePCR944WS150 Sequence/Annotation Release
Overlaps_Gene R05D3.4 Source_evidenceePCR944WS150 Sequence/Annotation Release
Chunk_score Abs_score839
Max_abs_score839R05D3.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII83585848359741
Overlaps_transcript R05D3.4b Source_evidenceePCR944WS150 Sequence/Annotation Release
R05D3.4a Source_evidenceePCR944WS150 Sequence/Annotation Release
WB_DNA_textsjj_R05D3.41158caagtagcccgagtgacgatggacaacaaaaacgacgcaaaattcaattcgaaccggtccgaatgcccgctgttagcaacgtggtatgtctttcatttaaaatcgaggatactattaataatccctaacgatttcagaacgatataagagctcgtgccgtagtttatcagacatctaaattaaagcagcaattgttgtacaaaaataagcgaatagccgaattggaaaaagaaaatgaacggtccaagaggcggcagcagacagacgaaagcaactttctgaaggtttataatatgttctcagatgtacgtttttacttattttcagattgcaattagttattttctttttcagattgagaaatacatatgtacacaaactaagaatgagtttggagaatacatcggaggagacactgcaccaactggtatagacgttcttggaatgactaatgaaacatataacaagttctttgatcaggcaaagcagaatttgtgagttttaaattattaaaattcactcttaatttacatatttctatagacggaatgcattcgtatcgtatgctaaagcgcgccacgatcgggctcacgaatccaccattttcatcgataaactaaaaacattgatcgattctcctaccttcaatccaaatggtgtccataaggagcttacagccaaagcagcaagtttagctatacaaaatgaaaagcttcaatccgaagttaccaaagttcaaagcgattgttacaatttggaacggaaaaagcgtattctaacggataagctttctgtacaagagaacagagttcaagaattagaacatcaattggaagatgcccgatttgaaactgacaaacatatgcgtcttgctaacaaatttgagtacaaactagccaccctcgtctcggagggacagtctggagggaacggaggggcgacaccgtcttcgtcgggtacaacaaatgctactgagaagaagatatcagctccagatattccaccaagtgaaacagctgcaaaagaagtgagatttaaaaattttttatcaatcgaaatgaataacgcatttttaaaaaataatttcagatcgaaaatctgcgtcttgaacgagatgaacaggaatccattgcatcacgacgccttcaagatctcgag