Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R05H5.5   

sjj_R05H5.5RNAiJA:R05H5.5
PCR_productsjj_R05H5.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR05H5.5 Source_evidenceePCR711WS150 Sequence/Annotation Release
Overlaps_Gene R05H5.5 Source_evidenceePCR769WS150 Sequence/Annotation Release
Chunk_score Abs_score685
Max_abs_score685R05H5.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1019980610201274
Overlaps_transcriptR05H5.5 Source_evidenceePCR769WS150 Sequence/Annotation Release
WB_DNA_textsjj_R05H5.51469cacggaagacaggtttttgattacacgtatttactaaaacaattgaatttttaaatttttaaaaaaccgaagaagtgaaaagtgatcccgtataagtggagaatgtcttggcggtgagcacaacgatgatgttgtcagtagcagaaacggctgggaaaaggactcgttgcacttggatatgtgagaccagcaggaagatttgcatcacaatttggtaggaagttcgatgagaaaggcagaagacgaaggagatgaatactgcgacatttcctggaattgattttattttcagacaactgttgaatttaaaaaataaactgttaccataatatccgagaagtgtcgatgcaatcagctgccgataatttgtttcgtcatttttccaaagtgaatacatcaaaatggcactgatgaatgagaatatttccacgacagagagcagtaaacatcgatagaacctgaataaaaaaaattcgttttttcttttgctttaataagtaaaagctcacatccactcctgatcggtcaattctttcgcttcgttgtttttattatcacgaatccaaacatctgcagcatgactcagccaaaatatcacaaaaagacgctcgggtcgttgaattctaacattgagaagaagatgtcgatatgcttgaacgtattggagcattaaatcgataacaacgagcaccacgtcatactcgatgtacttgtccacaacttctccacaattatccttaaaatatcgaaattaatattatatttaagaaattcaatttacttacacattctgttaatcgaataactccctcggaatactttttgtacaacgtcgaagtgaattcctggcaatttacgcatgcaaattcttctttttccttgctcactgatgcactttgatttttatatcgtgttttccacatttctgaaaagaaaataatagttaaaacagtgaaaaacgacatgaaaatccaaaaatgtgacgattatttaaaacaatatgaaaatagtgctctgtaaatcgacacaaatgtcggctctggtggccgatggccgtggcctaggaaacacaacaatgaaattaacttgttttagaaatgtttttattaatatttttgtagttaaaacaaaatttggaaatgtgcaattaaaaatgattttattattttttactttagaaatccgaaaagtatcgaatcgctactttttttttcgggtaccgtttctgtctttcaacaattttctatttgaataaataatacagtaactgtacaaagcattttatttaagttaattgtaaaaaatagaaatttgaaaatttttgggggaaaatcgaaagacatgtgagcagactaactagaaaataatatctgaaagactgttgggggcgctattgtacaaaaatatatgaacaacataatgtttcttgaacgttctagaacatttccagatcatcgtttactgacaca