Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R06A4.4   

sjj_R06A4.4 RNAi JA:R06A4.4
Simmer:R06A4.4
PCR_productsjj_R06A4.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR06A4.4a Source_evidenceePCR1116WS150 Sequence/Annotation Release
Overlaps_Gene R06A4.4 (3)
Overlaps_transcriptR06A4.4a Source_evidenceePCR1116WS150 Sequence/Annotation Release
WB_DNA_textsjj_R06A4.41131attcgtgcgacagtaggtatcattgtcacgactatcgttatggaggagaatatgtgcgattggccggaccttctagacactctggccacagttctgatgcaacccgacgagctgatgcaagaaggcgctcttggagcacttcagaaggttttcgaagactcggcggatcggtatgagtcggaatttcttcggccaatcatgccgaagcttcttgttttctatgagcatcatgctgcgaagatgcgggctcttgcaatgaattgtgtgaattgcattctaatggttaataatgatccaattgattttgcaatagatcaatttcttacttcgcttttcgctcgccacaatgacaatgatgaggaggtgcaaaaacagttatgtagatcgctgacgcttctgctggacacacacatcgagaaaatgatgcctcatttgccgaatgtcatagaatatattattaagaagactcaagatcacaacgagtcgattgccttagaggcctgcgagttttggctttcaattgctgagaatagtgatatttgccgaacaatggtgcttccacatctcgataagctcataccagttctgcttggctccatgcgatattctgagacagatcctgcgttgaaagctaatgatgaagatagttcggttcctgatagagaggaggatatcaagcctaggtttcataagtcgaagcagcatggtcttggtggccttgtggagtcggatgatgaggaagacgaggacgatgatgacgatggtggtggcgactggaatatcagaaggtgttcagcagcatctttagatgttctggcttctatttttggaaaggatctgttggataagctcttccccctcctcaaggacacattgatgaatgacaactggctggtcaaagagtctggaatacttgcgctcggggcaatcgcggagggatgcatggacggcgttgtgccacaccttggcgagctcataccattcatgctggctatgatgtttgacaagaagccactcgttcgatcgatcacgtgctggacgctgtccagatatagttcgcatattgcatccgacgagaacttcaggcaacagtttttcaaggatgtgctcgccaatgtgagaatttagaat