Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R06C1.4   

sjj_R06C1.4RNAiJA:R06C1.4
PCR_productsjj_R06C1.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR06C1.4 Source_evidenceePCR255WS150 Sequence/Annotation Release
Overlaps_Gene R06C1.4 Source_evidenceePCR413WS150 Sequence/Annotation Release
Chunk_score Abs_score350
Max_abs_score350R06C1.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1193062511931699
Overlaps_transcriptR06C1.4 Source_evidenceePCR413WS150 Sequence/Annotation Release
WB_DNA_textsjj_R06C1.41075aatatccctcccgtaaacctacacaaaatcgaccgtagtgcggcacgttcgctgcgagacccgccgcgcgtttggcctcaatctttttaggactgccaaattcgatcgaacatttttagtctgtcttccacgcggaaacacactcgtttttcttcaaaaaaaaatctatcatggcttcccaaggattctccgtctacggtaagtatagtaataaatcggtggtgaaaattaaatttaaatttgtacaaattttgaatatgatacaaaattctcaaaacttctgaaactttctcacacttttcttcgatgaacttttcttcgacttgcagaaagtatcgatttctgataattgttagcgttttccgatcggccttcgttctctatggttcattcgtgttccttgacaacaaatcccgatatttcaggtagtccccttccacgtgtataagtataactgagtctactaactgagtacccgggaccccacacggatcgccacacaattctggaaatggagacgccgttcgaccacaaaaagtatgggtgaagagacttttcgcactgtcatggtctccgtagtctaggactaggatagggtgcatttgctctgtaacagtgcattgtgagagtttgtaactttctatatataggccaaaacctactattacccccgttttgctaatcgatttttttctagttggaaacgttccataccaaggaactgaggaggagatcggaaactacttcgccgccgtcggacatgttaacaacgtcaggtaagagaactcagaaactcagaaactcggaaactttcgattaaaaccttgtcaaaactaatcaatgtcttccagaatcgtgtacgatcgtgaaaccggacgcccacgcggtttcgcattcgtcgagttctccgaggaagccggagctcaaagagccgtcgaacaacttaacggagttgccttcaatggacgcaaccttcgtgtcaactacgccaacaagtaaactgacaacgccgccgagtgactcaaagagattgcacttgtgatatacattccaccaaaaattctatcttcgtgca