Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R06C7.7   

sjj_R06C7.7 RNAi JA:R06C7.7
PF:GL1_6D11
PCR_productsjj_R06C7.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene R06C7.7 Source_evidenceePCR1029WS150 Sequence/Annotation Release
Chunk_score Abs_score966
Max_abs_score966R06C7.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI72491257250306
Overlaps_transcript R06C7.7.2 Source_evidenceePCR1029WS150 Sequence/Annotation Release
R06C7.7.1 Source_evidenceePCR1029WS150 Sequence/Annotation Release
WB_DNA_textsjj_R06C7.71182tcaaattcttcatcccagccgtcgaaattgacatttatcagtcttccatgaactgatttcactgtagctggacaaataaactgattttcacacatgtcagcagcttcaaggcgtagtcctaccttaaaacaagaaacaattatgaataactattaatagtgaaacaatctcaaacgatataaaacaacccgtttggaaatcagaattaccttaaatttgtctaatctctcttgggaaggcattggcttgaacaagtcaagcggtagggtttctgcagattctttctccaagtattcatcccatctgaatgttcctttgaactcatctggcggaacaagttccaaattatacttttccgcataaccaactgggaacataaatgtattattgatatgaataggaaaactgtcttcaagtgcatctggaccatccattcccacaataagatatccttcagttttgcaaaatttgagaatcgaagcgacgtggaggttattgaattgctgagccaaggggtcgatgagctcaaacttttgtccaaccttaacttttctccaaatcatgggatcaattggatcttttgctaattgatcaaatgtgacgtcgtctgagtcatatcttggattttctccattttttattgcttgagcaattttatttgtgtgctcaatatattcctttttcgcatttagttgatatccattgactgctgcaaatccaacaggaaatatgaagaagcttccctcgtctatccaatattgagatccagagctaaagacttgtctgtcgtcatctgcatctggaagcgattcgggaaagtctttctttgtgatagatacattcattcgtcgtccacatatttcttgaattcgcgctacgcgtatttcagtagaattggaataatttaatagttcaagacgttgtccaactttgaaacgatgcttgcttaggagagccttcccttcatcgaattttggagacagcgaagtttggccgacgatttcgccatcaatgcaattctgaagttgtgagatgatattaacataaattcggaaaaaaacaaacttacatttacataatttaccatatcattttggtattcttcgttgattgcaagcggcggagcatatacaattttatccatattgggatcactcattgcggcgctgaaatgttcaaatt