Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R06C7.8   

sjj_R06C7.8 RNAi JA:R06C7.8
Simmer:R06C7.8:Screen_A
Simmer:R06C7.8:Screen_B
PF:GL1_2F2
PCR_productsjj_R06C7.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR06C7.8 Source_evidenceePCR953WS150 Sequence/Annotation Release
Overlaps_Gene R06C7.8 Source_evidenceePCR953WS150 Sequence/Annotation Release
Chunk_score Abs_score890
Max_abs_score890R06C7.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI72536277254668
Overlaps_transcriptR06C7.8 Source_evidenceePCR953WS150 Sequence/Annotation Release
WB_DNA_textsjj_R06C7.81042accgtctcgtggtaatttcgtcacatcgacccccgcacaaggagttcatttggtcaacattgatgaatatttcggaaataaagaggaggaaagcactcacgaacaggaagctccagtatttgttgctccaaccagcagtactttcagtaaattagtaagtgccagacaaattttcgacatactattcaaactttttcagacacgtcgaaagtcactagcagcaaatcaagccgttcagccctcagtcacagagtcatcaaagcctgaacgatcagatcctaaagattcatctatcgattgtttgacagctaatctaggaagacgtctttcaattggtgctgatgaaattccaaatctcactgaaaacaacgaatctgaaatcactggttgcaagattcgtcggcgcagtgaaattatcaagcaaggagacatcaatccatgggacgaaactcttcgaaaaaaattgatgtgtcttgtgcgtcctccccagaatatgcacgagttccaagaacgagcaccgaagattcaagctctgagagactgcgaggttagcggagaaaagctccacattcaaactcttattggtcaaggtggatacgctaaagtataccgggctgtaaccgatgatcaaaggacagtagctgtgaagtacgaggtgccatcatgttcgtgggaagtgtacatttgcgaccaaatgcggaatcgcctgaaagatcgaggtttggagctgatggccaaatgttgcattatggaagtgatggatgcttatgtttattcaactgcttcgcttcttgttaatcagtaccacgaatatggaacgctgcttgaatatgcgaataacatgaaggatccgaattggcacataacctgcttcttgattacccaaatggcccgagttgtgaaggaagtccatgcctctaaaattattcatggagatatcaaaccggataattttatgatcaccagaaagtatgggaaaacatttgttaattttagacgttatcttttttcaggatcgatgataaatggggcaaagatgctc