Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R06F6.1   

sjj_R06F6.1 RNAi JA:R06F6.1
Simmer:R06F6.1
PF:GL1_8E5
PCR_productsjj_R06F6.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene R06F6.1 Source_evidenceePCR821WS150 Sequence/Annotation Release
Chunk_score Abs_score741
Max_abs_score741R06F6.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1078563910786621
Overlaps_transcript R06F6.1.1 Source_evidenceePCR821WS150 Sequence/Annotation Release
R06F6.1.2 Source_evidenceePCR821WS150 Sequence/Annotation Release
WB_DNA_textsjj_R06F6.1983gaggaagacgatgagcttgctagtagacttgaagaagaaagacgttgcaagagtgaatctcgcagaaagggacagccaaagagggtacaggatttcgcattttataaattaaatgctcattagcatattttaatttttttccaggcccagaacagtcaaaacaagccgaaattcgttcgttcacttgagctgacaaatgaagtgttccagtcaacgtcttctcgtcgttcacaaagaagcaaatcccgaacacgtaacggagacaccatcacaaccgtcgaggagcacacagaaactgtcgttatggaatcctcttcaggcccgataagccgtaaaagatgtttgtcaaatgcgtcaaccattaatgaaggtgcatcaccttcaaaacgtcgtccagaaactgggaaatcgaatcgtaaagcaccacgaggccgtctgttcacaaatggtggatccgatagttcgagtgtggcgagcagtccgtcacgaagggatcattgggaagagccgactctcggatggtgcactgatgaggctgtattgaagagacgctcaagggtaattatttggacattagtggctttaaaactattctgtttgttttcaggaaatcgacagagccaaggaaaaggctgtctatcaacgatatacttcggaggtgccacttcgcgatcgcatcaagggacaacatccacgaaccccaaataagcttataaacttcagtcgccgcagttgggatactcaaatcaagaaatggaagagaagcttgtacgagtattgtggagaggagccatcagattctgtcaatacttctttctgttactcagattccgatgcattgagtgaggccggtgacaacgataaggagattgagaacagatctgttctccgagatcttgtcattccagtcactgtatgtttttaaaattattaaacttattttaaagcaaaatattcttttttcagatgcgaccagaagttga