Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R08C7.10   

sjj_R08C7.10 RNAi JA:R08C7.10
Simmer:R08C7.10
PCR_productsjj_R08C7.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS R08C7.10a Source_evidenceePCR972WS150 Sequence/Annotation Release
R08C7.10b Source_evidenceePCR972WS150 Sequence/Annotation Release
R08C7.10c Source_evidenceePCR972WS150 Sequence/Annotation Release
Overlaps_Gene R08C7.10 Source_evidenceePCR972WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIV44437544444918
Overlaps_transcript R08C7.10c Source_evidenceePCR972WS150 Sequence/Annotation Release
R08C7.10a Source_evidenceePCR972WS150 Sequence/Annotation Release
R08C7.10b Source_evidenceePCR972WS150 Sequence/Annotation Release
WB_DNA_textsjj_R08C7.101165ggcgccaaatatgtgaaagttgtgatcgcatttggtaggaatccttcaatttgaccaagtttcgaacagcatagctcattgtcgtgcgagatgttgatcaaaagacggcacatcagggccagacacgagatgtactttttgacttcttcctctgcaagttgatgaactctatcgagaattacttggagaaatctgaaggaaaatataataattttttgcattaattgaacgatttctcacttggccaggctgctgataagaatattcgatcgatgagatatcagaaacgcttgattcttcttgtggaaaacggaactctgaaaaaagggaaatatgaaaaattgtgaaattcgaaaattgactcactgattccaaaattctaaaacatcgatttagaatcaaaatgctatacgtatcatcggcattgtccgcaatcaagtttacatttgtttcaactgaaattaatttcatatttttaatattgggtcaaaaaaactccaactcacttttcgcaactacaaactggagaattccgagattcaataattcgcttttcaaattatcatcattcacagagcgactgcagataaaaacgagagcttcaattatcagtgatgatggagtcaagctttcctttctcatatcaaatgacaccttttgtcctccaacttcttgcttttcgatgtacgaattgaacacttcccagaccatattcacaactttatccttgtcttctggacgttgctcgaatttttcgatacgcagaagttgcgagacaagtctcaacgatggaaaatcgattttaattgaattaaagtctcttgtgagcaaatagagaactgtcgaagctgccagcgcgaatagatcatcttccggagagtccataagcgccttgacgatactttttgtcatattctcacttttgataaactggcggaaatctggagagacacacttcttcgcaagagatattgcactgaaatttgataattaatttcgtccaaaaacatttttttactacctgaggcacttgactttcatcgatgcgtcggaagattgcaaactgctcaaaatgtagacgagatcttgtttaaaatcatcgtattctccggattcccgcagctcattagcctccttgatatgcctgacacgagatccataccca