Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R08D7.2   

sjj_R08D7.2 RNAi JA:R08D7.2
Simmer:R08D7.2
PF:GL1_8E8
PCR_productsjj_R08D7.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR08D7.2 Source_evidenceePCR873WS150 Sequence/Annotation Release
Overlaps_Gene R08D7.2 Source_evidenceePCR873WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII89683868969446
Overlaps_transcriptR08D7.2 Source_evidenceePCR873WS150 Sequence/Annotation Release
WB_DNA_textsjj_R08D7.21061catttgtaagcccgattgctgaaaaaagtgaacccgtggattcgcaattcaaaaaagaaccttctatttggctggtgaccgattcggtaagtgaagagaaatgctcactaatatatttaagtgtttcagatcattgcgaaagttcaagacatgaaactaagcgaagaagccgaagaaccaaaatctctagatccagaagatcaagatatcgaaccatttaaattaactgatgatgacaaagattttatcaaatctatcaaggaatttagaaattcgaattttggtcctccatcgacttcgaaacttttgaaaacagccccgaaacctgtactatcagcaaaagatcgtaaaaaagaagacgaagttctcgcaaagctgcgtgcaaagtatggaaataaaaatgctctgcaaaagaagccaccaattctgattgaggctcaagagatccattcaaaattgaaaactatggaaaaagcaaaagaagcgtggctcgttgatttaattaagttagaaaactctcaaaatataaattttacaaataattatctcatttaagatcctggttcacacctgaaactcgtaaattggttcgagaaggtgccagaccaaccggtggagctgctgagcaaattttgatggattttttgtccggtaaaaaggtggacgcggagaaattggtcaatttgccgaatcttgataagtacaatgtgaaagagaagagattgaatattttcctgcattctattaggaatcagtgagtttatctagcaattttaaatattaattttgaaattacagctggatggatttggaagcacgtttacatttaactccaactcgtcgtgatattctcagtcgagtagcttcgacattccaactcgattcggaaaatatcactggctggacaaagagagaaattaattctatcgttattgctcttttcattgtgtaagttctaaaaaatgcataattaaaaaatttcaaaatgttgaaatttaggatttgcctcgtcgatgttgagcttggagacgactacttcaagaaggacaacgcttctccag