Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R08F11.6   

sjj_R08F11.6RNAiJA:R08F11.6
PCR_productsjj_R08F11.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR08F11.6 Source_evidenceePCR55WS150 Sequence/Annotation Release
Overlaps_Gene (9)
Overlaps_transcriptR08F11.6 Source_evidenceePCR357WS150 Sequence/Annotation Release
WB_DNA_textsjj_R08F11.61195gtgcggcgatcaattattttccaattgcaagtctcttcaaaaaatatgatctcaaatcacaatgttcttctttacgcggcctatacttccacatgccttgtgagtttttttggatctacagtattaaacaaactacaacgttacactacaaactacaatgcgaacacgacaaactacaaaatagacactacaaataaaccaataacattttaggaataccgtgcctggtcgttttttgtcacaatagtcctagaatcaattggcgggatgttttttgtgtcgattggccaagtttcggaaagttcgctgcaaatggtatttggaggtgttttggggcagtttatagacaaaatttgcaggaaaaaaggttaaggttttgaaataaaacatttgaatttcatatttcagccatcatcatggtcatgtttttcaataactttagtattcttctccaagttatcttattagttggtaagtatcaggttgtcccataagtttttgtactttttttcaaatatttttccaaaacttctagaaagttttaaaattttttcatcgtaggtcgtgtcaaggtcgggtcgtcccctttcagaaaagattcatttcatccatttctactttgccacgatgacaatcatcaaacttgaacgtcgagacgttagattgcttcttctttatgaatttcgtcttggtcattcagcaatggaagcggaacgaaacatatgcggtgcgatgggtgagggagcactctcttataatacagcaaagagttggtttcaaaagttcaagaacggcgacttcagtctcgaagaaatagaacgttctgggcgaccggtagagttaaatgaagaagacctagtgaagctggtggaggaagagcctcgtcttagtcttcgtgaaatggaagagaagcttgagtgttgtcatagcacaattgcacgtcacttgggtcgccttggttttacttcaaaacttggaacttgggtgcctcatgaactttcggcatcacagaagctcactcgggtcaacgtttgtactcaacttctaacttttcgtcgaaagttcgattggctgaacaatctggttactggagatgagaagtgggtgctctatgttaaccattccagaaaacgtcaatggcttccgatcggtgagaaaggaataccgacgccaaagcctgatcttcacccaaaaa