Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R09B3.4   

sjj_R09B3.4 RNAi JA:R09B3.4
Simmer:R09B3.4:Screen_A
Simmer:R09B3.4:Screen_B
PCR_productsjj_R09B3.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR09B3.4 Source_evidenceePCR543WS150 Sequence/Annotation Release
Overlaps_Gene R09B3.4 Source_evidenceePCR606WS150 Sequence/Annotation Release
Chunk_score Abs_score564
Max_abs_score564R09B3.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1191118811911966
Overlaps_transcriptR09B3.4 Source_evidenceePCR606WS150 Sequence/Annotation Release
WB_DNA_textsjj_R09B3.4779attttcatcgatttttgacccttttacactgtaattttgccaaaaaaacgattattttctctatgtttccgtatgcgccgcctatatcgctgaaaattatcgtatttcttaatttttcgctttcagaatgttcaatcttcaaaaacgaatcaacggcaacaacgaggacggtcggtatcttgaaacccgcatcgccgtccgtgacaagctcctagctcagggtatgtggctgctttataaaaaattttgattttacaacattttcagaactccaacagctggagactgctcttcgcgatcagaagcaaaagctgtggcatctcgaggtcccatcaacatcgtgtcttcatgagttggaactcaccgtgacacctcaagaaggaatctatcgtggaggcaaattccgattcaagatcaccgtcccgccagagtacaacaacgtgccgcccgttgttaagtgcctgacaaaggtttggcatccaaatatcaacgaggacggatcgatttgtctatcgattttgcgtcaaaactcgttggatcaatacggatggcgtccaacgcgtaacctcaccgacgtcgtccacggactcgtctcactgttcaacgatcttatggacttcaacgacgcgctgaacattcaagccgcccagatgtggagtcagaatcgcgaatcgttcaatcatcgtgttcgggaatacatttctagatattgctaaggaccaacggatcggattacaaatggcctgtgaattgaccccccctatgaaattgattttgat