Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R09E12.4   

sjj_R09E12.4RNAiJA:R09E12.4
PCR_productsjj_R09E12.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR09E12.4 Source_evidenceePCR661WS150 Sequence/Annotation Release
Overlaps_Gene R09E12.4 Source_evidenceePCR661WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRV771399772558
Overlaps_transcriptR09E12.4 Source_evidenceePCR661WS150 Sequence/Annotation Release
WB_DNA_textsjj_R09E12.41160ggatttagtggggttagatggtcgcagtactgtaagggtactgtaggattactatagtttagaaaaaattcactgaagtttaaaggaaaagtcgtggtgagacctatcatggctaaagccattcgttttggcgggaattcaaattttctgactatgagaaaaaattttggcaagaaattcaatttctgagaaaataaaactttctagaaaaattttgaaaattgtggaattaatataataaaaattttaaaacgttaacctttttcagccattcatttcttaaaacaaaatcactccgaaaaacgttgatctggctcttgattcctgttatctacggtttcctctgggcagtcaatttatattgtacactatgggtcaacacggatactgaacagatattacaggggtgagtaaaatgaaatgcttgttgtactctgttgaacttctcaggaatgggtatttacgcgagaataagttaaacatatccgacgtaacatatattgggcccaactattggaaacttgatgaaaatagaaatgaagttataaattggagaacaatgttgggaatgtctattgcatcgacactgatctcgatttccttcgcaatgattgtcatttttgcaactttaagctacaaagaggtctccaagctaaccgagctgacttcccactccgaaaaattccgttcaattcaactgcaacttttaaattctttggtgttgcaatcacttgtcccggcgtttttcatacagttgccatcgttcgtcctatttctggcgcctttttttcattgtggaaggccagtgtttggcgagataattggtgtgacggttgctctatacccagtcttggactcacttccaacaattttagtgatcaaggctttccgtgaagcaatatttcgtgagtaaaagttgccagccaaataagttgagtgtattttccagattgttgcccattcactaataaaaatgctacacttcccacatccgtagcactggttactattcaataataatacattcaatttaaatgatagaaaatggactgtataacttaatcgaaacttgtttttacactttgcaagaatctgattattttaaaatttttgtagatcacaacgatatgggacattatgacaccacgagagaaatgtct