Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R09E12.7   

sjj_R09E12.7RNAiJA:R09E12.7
PCR_productsjj_R09E12.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR09E12.4 Source_evidenceePCR347WS150 Sequence/Annotation Release
Overlaps_Gene R09E12.4 Source_evidenceePCR347WS150 Sequence/Annotation Release
Chunk_score Abs_score305
Max_abs_score305R09E12.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV764759765466
Overlaps_transcriptR09E12.4 Source_evidenceePCR347WS150 Sequence/Annotation Release
WB_DNA_textsjj_R09E12.7708agaacgtcagttgaaaactctgcgtctcaactcccgcatttttgtagatttttcgtagatcaaactaaaaatggggcactctgacaccacgtgactatctaagatgtccacgcaacgtgttgtgcaatttgtctgcactccccttgcaatcattacaaattgcactttaattcttttcgttcttaaaaaatcgccagaaagtctgggactctataaatatctgatgatttatattgcggtttatgagctgcttttctcaactctcgacatacttctcgccccagatgcctattcttacgatacaatctttatcatgatcacgcgagccgacaaactgattctaccaccatgcacaaaagaagtggcatcgatgatgttttgtgttcttttcggagaatctcttgcagtgttttccattcattttgtctacagatacttggccataacggggcgagttttcgaattgcacttatcattggtttcattggggatatggccagggtacggtagttgtgctgtaggggtactgtaggattactgtagttctggaataattgactttccgttatttgaagggttttgggttattggggttacatggtcggggtactgtagtagcactgtaggggtactgcaggggtactgtaggatgactgtagtttaggaaaaattgacttttcgtgtttaggaagaatattggtttggggt