Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R10A10.2   

sjj_R10A10.2 RNAi JA:R10A10.2
PF:GL1_7B3
PCR_productsjj_R10A10.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR10A10.2 Source_evidenceePCR339WS150 Sequence/Annotation Release
Overlaps_Gene R10A10.2 Source_evidenceePCR467WS150 Sequence/Annotation Release
Chunk_score Abs_score404
Max_abs_score404R10A10.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI64203966421905
Overlaps_transcriptR10A10.2 Source_evidenceePCR467WS150 Sequence/Annotation Release
WB_DNA_textsjj_R10A10.21510gacacgtttgaagactccttgacggtggaaaaactctggaaactcggataattttctataaaatattcaaactgtaaatgttctcacctgaactcattcttaaatatatctatctcagtttcagtaaaatctagaagtatctgttcgtatagtccgccagacaatcgaccatgtcacggctggcgtcttttgtttttctttgaaattttcagaatcattttttctattgctctgcttctttgtgttcatattcgtgtatatgtcgtctgtgtgtgtgtgaatttttatttacagtcattatttttgtgaatgggaacaaagtggagaacggggtgaaaaatggagagggaagaagtgggtgaagagacaatttacagacaaaagttcttttgaaaaagagtcgaaaaattacatgtaaattgggaaagaacgtgtaaaagtagataattgatacattatttgctcgtgcggctgacgacccaatccttttgacacagtgggcatctgttgttctgtcgaatccactgagtcatgcaacaatgatggaatgaatgattacagtctccccacactacgtagcattcagcacttggttcagattgacaacgaagacactcttctgaaaaaagttgttcataattattggattaaatctcattctggtagtgtggatctcctgctccctatgcatatttttaaaaaatgttgattttaaatatatatttgcaagctaaaaaaaaaggacaatatatttcaatttcgacatagttgtatattacctattctgttcacgaaaatttgcgtgttttttactttcaaagcaagcacttttgcttgttcctgaacttttaaatacaaatatatctttcaaaagaatactttttgaacatatcactaaaaaaatttagctgcatatgagcacttcgaactagtaaaaagtcgatctgaactttttcagtgcatttttccacttttttcaagacctctagaaatgctccaaaatattttttttcgtaagtttgtaatgatatttaggggtagagaaatattatggaagatttctgtagaattgtgtttttttagagaaaaaactgaaaatttttttaaaccaaaaaccatcataaaattatctgcgacatttttatctcacaaaatatcaaaaaaataagttttgttatatttttgaagcgattcaactttttaaccactgaattaaataaaatttacccattaaatgtactctgcagattgcacatgtgtcacattcaacatcccaggcccaaacagctaacgcattccattttttgagcacaaaaggacgactttcagacggattcgcggttttttgctttctgaaagtaatttatatttcgagaatttaattgaaatggaaataattgacttactgagcactcgtacttccttcttgtgaatctgcattgcttgaattgttcattttttttgcaataatttattgatttattgaaattattggcaatttaagaccggt