Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R10E11.1   

sjj_R10E11.1 RNAi JA:R10E11.1
Simmer:R10E11.1
PCR_productsjj_R10E11.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS (2)
Overlaps_Gene R10E11.1 Source_evidenceePCR1174WS150 Sequence/Annotation Release
Chunk_score Abs_score1153
Max_abs_score1153R10E11.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII97704079771580
Overlaps_transcript R10E11.1b Source_evidenceePCR1174WS150 Sequence/Annotation Release
R10E11.1a Source_evidenceePCR1174WS150 Sequence/Annotation Release
WB_DNA_textsjj_R10E11.11174caacgatcgaaacaacatggcaccgaaaacatcgtttacggaacagaagaacagtgttattgattatgagcctttcgagagatgtaaatattgtatgaggaaatggcatcggatatgtgcacttcatgataagaaagtttatccagaaggatttatatgcgaatgttgccggactgctaagaaatatcaaaagccagataacaagtatcttgctagcaaattgccacataataagctgtctacattcctcgaagatcgtgtcaacggtttcataaagaagcagttacaagcagaagctcacaagtatccagtcatcattcgaacactatgtgtacaggataaagaagcagaagtcaaagcgcagatgaaacagaagtacgtggagagcaatcaattccctgaaaagttcccctatcgcacaaaggcagtttttgccttcgagatcattgatggagtcgaagtgtgtttctttggtcttcacgtacaggagtacggtagtgcatgtcctgctccaaatgctcgacgtgtctacattgcctatctcgattctgttcacttcttccagccaagggagctgagaaccgatgtgtatcacgaacttcttttgggttatttggattacgcgaagatgctgggctacacaatggctcatatttgggcgtgtccaccatcagaaggagatgactacatcttccactgccatccaccagagcaaaagattccaaagccgaagcgtctccaggattggtacaaaaagatgttggagaagggagtgcaggagggaagtgtcgttgaatttaaggatatatacaagcaagcaagagatgataatctgacaactccaactcagttgccttatttcgaaggagatttctggccgaatgtgattgaagattgtatacgtgaagcatcgaacgaggaagctcagagaaaagtgaaagaagatgatgatgatggtgaagatgcggatggtgggctcggaggtggtgatagcggcaagaagaagagctcgaaaaacaaaaagaataacttgaagaagaatgccaaaatgaataagaagaaggctggaagtattactggaaacgaagttgctgacaagctttactcgcaattcgagaagcacaaagaagtattcttcacgattcgtctggtcagtcttcagaatgagccagcc