Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R119.3   

sjj_R119.3RNAiJA:R119.3
PCR_productsjj_R119.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR119.3 Source_evidenceePCR683WS150 Sequence/Annotation Release
Overlaps_Gene R119.3 Source_evidenceePCR683WS150 Sequence/Annotation Release
Chunk_score Abs_score599
Max_abs_score599R119.3
Specificity_index0.536
Rel_score1
Map_statusBest_ePCRI377225379208
R119.4 Source_evidenceePCR645WS150 Sequence/Annotation Release
Chunk_score Abs_score519
Specificity_index0.464
Rel_score0.866
Map_statusTop85_percentile_ePCRI377225379208
Overlaps_transcript R119.3 Source_evidenceePCR683WS150 Sequence/Annotation Release
R119.4 Source_evidenceePCR645WS150 Sequence/Annotation Release
WB_DNA_textsjj_R119.31984tcgacataagaagcaacatcagacggtcttccaagtcttcccaacggaatcatcgattccaagtgttgtttaatctgacgagcttcttctccagaagcatgatcccatacagcaccagttccgtctccttcaatcattccagacaccacactattcacgcggactccttgtttcgcggcactctgagctacggattttgtaagtgataggacactgctagatgcaactgagtagagacccatatcgattgatggagtgaagccgaaacatgacgttaggtagatgatactgccgtttctggaaaaaatcgattttttttggacgggaaattttgcctgcctacgtgcctacctgccggcctattttagcctatttttcattttttttttgttgttctatttttttgccgttttttgggaatttcatgatttctagggtaggcacgacttcatgcctacgtgcctatctaccggcctaacatttgatatttttttagaattccatgatttctaggtaggcaggtaggcacgaatacatgcctgcctaccgcctgtttttttgaaatttttttgtgtgaaaaattaaaattcatgggaatgctttttttttcaaaattcaatgatttttaatgcagaccgcgcctatctgcctaccgcctatttttggcattttttgtgtgcaaaacaaaatcaaattagcttttttcttttcgtttttctacgattttttccaaatttcaagatttttcggataggcacgacttcccacctactgtgcctacctacctaccgcctattttcggcattttttgtgagcaaaaagagatcaaattagctttttctcctgttttctacgatttttttgggtaggcacgactccatgcctaccgtacctacctacctacctcctattttcggcattttttctcgtgcaaaaaatcatatttatgaaaacactattatttttgttttctgaattttttttccaaattttgtgatttctagggtaggcaccgacttcatgcctacgtgcctacctacctaccgcctattctcggcatttttgtgagcaaaaaattaacattcttgaaaatcctttttttgttttactacaattttttcaagttgcatgatctctagggtaggcacgatttcatgcctacttgcctatctacctatttttcccttttttcgtggtttaggtaggcaggcatgagtcaggcacgaaaatctagaaacataattttgattctatcggtaaaataggctttcaagacagtttgaatttttcgaatttctaccagcaaaaaataatatctgaaattttcgcggcgagacccaaaaactgactgagatttggcgagcgtcgacatagcggcttgcgaaagacggaacggtgttgtcagattgttggcgaaaagctgaaattggtttttcgaggtcaattttccacgtggaattcaaatttcagcactctcgaaccttatcaaaatcctcgccggatgtctcaataatctcgccgagcacctcattctgtggtggaactataattaaagtgtccagaccgccgagcttctcagccactttcgtgatcagctccttcctgtgctcggcatttgccacgtctaatgagaaagctgtgacgtcacctccaacctgaatttattcccgaatttctctttgtcaagttctgaaaatctgcctaaacctttatattgtcctctgcaacctttcccacactattcggacagtctgcggcggcggcgaccttgtagccggtgaacgcgagtcttctcacgacggctttacccagtgtggacgttgccccgattacaagtgcacatgacattacgctgaaagcccgatgaggaggcatatttatagatacacctagacatcaggtacatttatttggaaatccgtagaaaataaagaacatgtgaaaataaaacagatcattttattatttagaggggagagggagg