Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R11A5.4   

sjj_R11A5.4RNAiJA:R11A5.4
PCR_productsjj_R11A5.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS R11A5.4a Source_evidenceePCR727WS150 Sequence/Annotation Release
R11A5.4b Source_evidenceePCR511WS150 Sequence/Annotation Release
Overlaps_Gene R11A5.4 Source_evidenceePCR847WS150 Sequence/Annotation Release
Chunk_score Abs_score784
Max_abs_score784R11A5.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI78710577871996
Overlaps_transcript (10)
WB_DNA_textsjj_R11A5.4940cgatatcaccacatggcttggagagaagtggcacattggagagccaggagttgctgctcatccaaactcgtaagttaacattgaaaattatagtttgtaaaagtaatttttcaggcgtttcgctgctccagccaatcaatgtccaatcattcatccagactgggaaagcccacaaggagttccaattgaggctatcattttcggaggacgtcgtccacagggagtaccactcatttatgagactaactcatgggaacacggagtcttcactggatcatgcctcaagtcagaagctaccgctgcggccgaattcactggaaagactgttatgcacgatccaatggccatgcgtccattcatgggatacaattttggaaagtatctccaacattggttggatctaaaaaccgactccagaaaggtaatcgattttttcatattttcagtaatttaatgttaatatttttagatgccaaagatctaccacgtcaattggttccgtaaggattcaaataacaagttcttgtggccaggattcggagacaacatccgtgttatcgactggatcatcagaagactcgatggagaacaagaaatcggagtggaaaccccaatcggaacagttccagccaagggatccatcaacttggaaggactcggagaggtcaactgggatgagctcatgtctgtgccagccgactactggaaacaagatgctcaagaaatccgcaagttcctcgatgaacaagttggagaagatcttccagaaccagttcgtgccgagatggatgctcaagagaagagagtccagacattgtaattattatacccgtttttcgcgcattatttcacggttatctaacagttttctgtttgttttattttttatttgaaacgcatctattgttcctatgtgagtagtgccttttcttcgcttcac