Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R11A5.6   

sjj_R11A5.6RNAiJA:R11A5.6
PCR_productsjj_R11A5.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR11A5.6 Source_evidenceePCR342WS150 Sequence/Annotation Release
Overlaps_Gene R11A5.6 Source_evidenceePCR342WS150 Sequence/Annotation Release
Chunk_score Abs_score321
Max_abs_score321R11A5.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI78669057867999
Overlaps_transcriptR11A5.6 Source_evidenceePCR342WS150 Sequence/Annotation Release
WB_DNA_textsjj_R11A5.61095aaattgcttctgatttcattccaccaggcaacaatacaaaagggacgaacaaaaaccaaatatttgctaataagattttattccattgcttttcttttcttctttccaatattttcttcttcacaataaacaaactattgtgtgtagtggtagagaccgaagacggtctgcgttttagaggccaaaagagcgatcttgaaaccaattacaaagcaataagaaggaggaggaggaggaggtgatctcttatcacttatcactgattgactcgctgatatcatatcacaccacgaggacagagacggggttttccaaacggcgattctcgaacagcgcaaagtacgcacttagatcttctacgactaggaaccatagaatattccagaaaagattcaagaaacgagagcgcacaaaaatgtgagggagggattggcacgcgccttgctttttcaaatggaaagtggctttttcaagcaggaaagggtcctcttgtacagcatccgagagggttgtttgttgagagtagccaacgaaaaactaaaaatttgtctcaagggaaaaatatttatttgggaataattttatatgctgtcgtatctacataagtttactatagttttggaaaaaattcactatcaagcaatttcagcatataatatttttttttaaataatggaaacaagtagttctttccgttctttcaaaaatttcaaagatagtaaattttgtcgaaatttaaagttcaaagtctcaggctcttgtggcttatgagctcccttcttttttcgaaacttcttgatatctacacgtggttgtttgcaaccttctccatcttctcctccccgtgtctgcgtgcaattcggcacaagtgccggggagtcggctggagcagttggtgtccctgtccctgacaactcggcccgtaactgcctctggtcaatcgatctaggagtgcctgtgagagaacgagatgaaaaaaaaactaaaaataaccaagagaaatacataaacaaatttttttcccagcatgaaagattctcgtgcagaggaaccagtttcggatagcattgaaatggaaaggtcaatgttcaaatg