Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R11A8.2   

sjj_R11A8.2RNAiPF:GL1_2E8
PCR_productsjj_R11A8.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR11A8.2 Source_evidenceePCR782WS150 Sequence/Annotation Release
Overlaps_Gene R11A8.2 Source_evidenceePCR782WS150 Sequence/Annotation Release
Chunk_score Abs_score719
Max_abs_score719R11A8.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1035799810359097
Overlaps_transcriptR11A8.2 Source_evidenceePCR782WS150 Sequence/Annotation Release
WB_DNA_textsjj_R11A8.21100tgcgtctcttgcattcaatcagtcaactctatcctctctcgtacacttttttagaaaatctttttacttttttgttttttaatttttcaagttttgaaaacatcaaatttctataaggagatggtggaacaaactacatcggagcctgcagcaggatctatgcccaaaatttcatttggcgtgaaaaagcgagaagagaacaaagttcaggcgcctgctaaagctgttgtaattgaaggtaatgtatttcttttgtaattcaaaaattattaaaattaaaatttttcagtcgatttggacagtgatgaagaacgagaaaaaaatgagatggaaagagcggccaagagaagaaaagttatgcattttgaggatggaaccgttcagtgagtaatatcatgaaagttccagaaattaatcgtaaattattgtgaaccaatttaaattcaacaaaaaatttggtgtacagtttcgattaaatttttttaaatttaaatatcaaattttttgaaaacgtctcatttattttttagaggcgatattgacaaaccaaaagaagctgccgtcattccaatggtagtagaacatgattggaggactcagaaactcattgaaaaggagaaagctggtacattaacagaagaagaacgtgccaagttggcacttgttctacccaacggaattgatggagaaaatgaagaagaaagcggaaaaggggagaaaattgttgtagaagacggacgcggtgatacagaagatgccgattattctgcaattcccatcgaaagcttcggacttgcaattttaagaggttgcaactggaaagatggtgatggaattggtaaaaacccgcagaaagtcgcattgaaacttccgaatcgacgaccgcctggactcggacttggtgccacacccaaaaatccagtaggaaaaaataaaaatacaggagaatcgtcgaaagcagaagaagaaaaattagaagaaattaaagttggaagcttcataaaagtagttgacgggcgaaataaaggtgtttatggaaaagtcgaaggaagagatgatgactcaaattcattgtttataagaactgcaatcggaggaaa