Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R11D1.11   

sjj_R11D1.11RNAiJA:R11D1.11
PCR_productsjj_R11D1.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR11D1.11 Source_evidenceePCR749WS150 Sequence/Annotation Release
Overlaps_Gene R11D1.11 Source_evidenceePCR749WS150 Sequence/Annotation Release
Chunk_score Abs_score666
Max_abs_score666R11D1.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1273443012735921
Overlaps_transcriptR11D1.11 Source_evidenceePCR749WS150 Sequence/Annotation Release
WB_DNA_textsjj_R11D1.111492ttcgaaaatcctccatcgacaggcaaagtggatccagtagtcattgaagcattgtctgaaagaaggaaaaggacagcattcacaacttcgtcaacctcagcaaaacgtttgatcggcattctgtcgagcatcttcttcttcttatcaggatcactccagttctaaaaagtctaattatgctctcttttcaatttgaaaattattacatctcttcccatatcagtcatcacaacagttggattgacactattaactcgaatattctgggatcccaattcatttgcaagacatcttgtgaccatatcaagagcagcttttgatgcacctgaactttcagatgtacattatttcagtaaagttttaaactaacaataaacagtgtgattatccaatggacgaatggctgcttgtgatgaaatattaacaattgatcctttgatttgtctatccacaaagtttctagcaactaattgtgcaatgagaataggtccccttacgttgactgcaaatgttctatcaattgattgttgagtaatttgtccaattgcatgatttgttgcaattccagcattatttacaagaccatgaattgggaaatgtggtacgataagtttgaaaaggacctcttcattggcactcacatctccaacaattggaattattgtatatctctgaaatattaatttaatcagattggtgtaatattttatattttcacttaccaaagaagtagtctctttgacaagactcaacaaatttgcttcatttctcgcgaatgcaataacctgcgctccagctttggccaacgaaaggcagatttcttttccaattcctgcaaatgtgataaattgtgatgtatgattcacaatcaccccatcggaagtcttcatgaacgatttttattctatttttagctttgttcgcgtaatatattttttaccgactaggaaggatgtactcttgttttcaatgccagaaatttcctcaaacataatcgtaaaataattataattttcaaacggaatgataaaatgttgatgatacaacaaatttttgattaaagattatagtgttatcatattatcgtatatcaacgttttcctctccatttgaactagatcataattacaccggaagtaatcagagagaccatcggtcttttatcacattggcctaaatttgaaatgttaaattaatatggattaaacattttgaaaacttaaaaagtacaaatcttcatgagatttcagaaaactgattcagtggctccaaatgtttaatggttttttttaattgagcagataatttttaacatttccttacttcaaactacaaataaacttatactagaccagggaaaacctggtcaacttcaattcaaaccttgcaaacatatctaaactcaaaacatagaacaatcgtcggaaaagagatttgacgttttccgtgaagttttcaactataggtcaaaagttgggcaataagttggcac