Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R11D1.8   

sjj_R11D1.8 RNAi JA:R11D1.8
Simmer:R11D1.8:Repeat_a
Simmer:R11D1.8:Screen
PCR_productsjj_R11D1.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR11D1.9 Source_evidenceePCR108WS150 Sequence/Annotation Release
Overlaps_Gene R11D1.8 Source_evidenceePCR445WS150 Sequence/Annotation Release
Chunk_score Abs_score413
Max_abs_score413R11D1.8
Specificity_index1
Rel_score1
Map_statusBest_ePCRV1272971012730886
R11D1.9 Source_evidenceePCR108WS150 Sequence/Annotation Release
Map_statusBottom50_percentile_ePCRV1272971012730886
Overlaps_transcript (6)
WB_DNA_textsjj_R11D1.81177taaccggtttcaactgaacctaaaatgtcgtgatcgacctttcgtcgaatgcatgcccattcaacgttgagccgatttgagtgctatttcaacatgaaatttttgattctgtcctttcttctcgtatcaatttgctctggaggtggtggattcccgattcaaatgttgacaaaatgtggaatttcaaaagaaaccattgatggcgttcaaagtgtaatcgacgaacattcggtatttttaaaacgacttcttagatattgaaaaatttttcaggcaatgattaaaattgctaactcgaacaagcgtgccaaaaaaaccgaaatcgattctttgaaggcagatattgatttatatttagatgaacatgcatctgacgacgacaaggtaggatttctaatctaaattttacatatttattttttccagaaaagatggattgagtgcttcacaaagaacaactcctaattgtcttgatttttcactttttttttgaataaaaaattttaacgtgttgataagctgtaacactttatattcataacaacaacgtaacaaacgtcatttatgcgtcagtcttttggaccttagccttcttcacttgggagcggacgatggcggcggcacgacgttgagcgagcttgttgaacttgttgaatccggcgttcttggccaagcgacggactgaagcaactggggtcttgctcaaggtggaggtggtgacggccttggctggtcttccctctgagaaaaaacagtgtaaaaaataaatttttaaaaaatctcttactctcgttcttggtagatacaacgactcccttggcggcggcgctgacgtcgatggcgtgcttgttagcgagtccactgtattttgggctgttcaccttcttgaggttgaacttctcagtggagaatcgctttccgattccgcgctgggttctgaggaaagcgctgttgttgcggatgacttgccacacgagagcgtcggacattttacctggaaataaattattttatgatgaaagttaaatacaataagatacaacgggaaacgtaagaaaaattcaataaaatcaattgtacacgtaggttttcaagcaaatttaagaatacaattttacaaagtcctaaatgtcatttttcctgctcaaacttttgactgaaatgcataaaaattcgc