Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R12B2.4   

sjj_R12B2.4 RNAi JA:R12B2.4
Simmer:R12B2.4
PF:GL1_6B1
PCR_productsjj_R12B2.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR12B2.4 Source_evidenceePCR932WS150 Sequence/Annotation Release
Overlaps_Gene R12B2.4 Source_evidenceePCR932WS150 Sequence/Annotation Release
Chunk_score Abs_score848
Max_abs_score848R12B2.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII58032715804355
Overlaps_transcriptR12B2.4 Source_evidenceePCR932WS150 Sequence/Annotation Release
WB_DNA_textsjj_R12B2.41085caaaaattgcatatgggccttgtcgccgatgacattatcaagccaaccgtaagtttgaacagaatattgaattcatcagcacaaataacccgatttcaggcagaaatagcgcaacaaatatttgctaattttgtgaggcttgtgttaaatgtgtcggaaagctcgctgacgacccttccgctgtccgccaactgtgattatgatccagaattgcataaaaagagcattcctatcattattctcttccaatgcatgtaagattttaattttaatgttagatttgctgaaatattttttcaggaaagcatttatcaaagataattctggcaacaagctggacttgacgatgtgcgatctcgtgacacctgcaaaacacgaacatcgattcagaaagctgacaagttttcttgtagattttctgaaacttcacgaattggccactccagcgttcaatgaaattagcgaagagttcagtgatcgaaagttcgaaatggaaaagattcgggaagagttgttagaagccgagaagaagaaaaatgatcttctcgcgaaacaaagcataagaaaacgtcatgagcatgaattaatcaacgaacagagcaatgcgaaggcagaacttaaaaatgttgtgaacgaatataccgaaactcgtcaaattaatgaagaactcgacaagcagaaagaagaagctattctgcacattcaagccctcgaaaaggaaatgctaactggtaaaaagacaattgagcatttgaatgaagaagttctgacatcgccggaacagctgaaacaagaaatggaggaaaggaaacgtcacattgaagagctccgcgattgtcttgaatcatcaaagtactgatatatcttcagtctctccaaaaattcaaaataaaagtaattattttcagaaaaggccttcaagcaaaactcgaggctcgtgaaatttgcatcaactcggagaagaacgtgccagtgattattgagaagatccatcagtggactgaagttcgagaagttatcattgacctgatcgatgttgaaagtgagaatcttcgaaagctcaaggaaatggaggagcaattgga