Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R12B2.5   

sjj_R12B2.5 RNAi JA:R12B2.5
Simmer:R12B2.5
PCR_productsjj_R12B2.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR12B2.5a Source_evidenceePCR1120WS150 Sequence/Annotation Release
Overlaps_Gene R12B2.5 Source_evidenceePCR1120WS150 Sequence/Annotation Release
Chunk_score Abs_score1057
Max_abs_score1057R12B2.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII58311145832305
Overlaps_transcript R12B2.5a Source_evidenceePCR1120WS150 Sequence/Annotation Release
R12B2.5b.2 Source_evidenceePCR1120WS150 Sequence/Annotation Release
R12B2.5b.1 Source_evidenceePCR1120WS150 Sequence/Annotation Release
WB_DNA_textsjj_R12B2.51192gacattccacccattgatccaggtgttcccattttttgattcggtgtacccattggattcattgaaggggctccagaacttggacctgacatacttgatccactcatcgaattacgatctcttccaattggtccaggaccatttggcattctcatattgtttctcatcgctgcaggattcgggtatggagcatgacgatgattgttgactggtgatgtcatcggatcgtgtcccatatctccacgatacattccatgaactggaccacctccaccctgcatcatcatatgatcctgtggcatcattcgttgctgctgttggtgttgctgttgatgccacattggtggttgatgcatttgcatatgtggtggtggaggtcccatatactgctgatgtccataacctggatgtcctccgtagggatttggcacctgaccattacccaacatagcatgttcaccgttcatcatcggatcgttcattcccatatgattctgattctgtgacattggagcaatattcaagaagtcttgctttctggcaatccacatctccaaatggttcaagtattcaaggctaaccacacgttttccttcgagcacactgagcataacctcaagcttgtgagcagcttcatggttaccctcatgtctgcattgccttgctcgtgttctcaaactgtcgcagcttccacgcatatttctcaatttcgcagaatacacggtttgatcctcggaactcatcattccctggtttggaaccattccgggtcgttgctgttgctgctgttgttgttgttgttgctgttgttgggcagctgcacgttgagcagcaacatttcgatctccaggtgggcccatctgattgtgatgtcctggatattgttgaggctgattgataagtgattcaagaactgatgaaggaccggttggagtggctccttgaccgttcattggtcttccaggatatccatgtggttgttgtggtggcattgcaccccattgtggttgttgttgatacatatgtgctgaaggatcccaaggacgagcttgatccatctgaaaaaaaaattaatcaaaaattgaaaaattagcagattaaaaaaaaatacatttgaaaaataaactcacatcctttttaatctgctgattgtacggatttccacccattggagcaccactaccaggtggtc