Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R12E2.10   

sjj_R12E2.10 RNAi JA:R12E2.10
Simmer:R12E2.10:Screen_A
Simmer:R12E2.10:Screen_B
PF:GL1_6C4
PCR_productsjj_R12E2.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS T21E3.1 Source_evidenceePCR1134WS150 Sequence/Annotation Release
R12E2.10 Source_evidenceePCR1134WS150 Sequence/Annotation Release
Overlaps_Gene T21E3.1 Source_evidenceePCR1134WS150 Sequence/Annotation Release
Chunk_score Abs_score1004
Specificity_index0.479
Rel_score0.919
Map_statusBest_ePCRI39328343934015
R12E2.10 Source_evidenceePCR1134WS150 Sequence/Annotation Release
Chunk_score Abs_score1092
Max_abs_score1092R12E2.10
Specificity_index0.521
Rel_score1
Map_statusBest_ePCRI41697874170968
Overlaps_transcript T21E3.1 Source_evidenceePCR1134WS150 Sequence/Annotation Release
R12E2.10 Source_evidenceePCR1134WS150 Sequence/Annotation Release
WB_DNA_text sjj_R12E2.10_11182caatgttccacgtgacgttcctcgcgatccggtccaatgagacgaagatgagtgacacggaacaatgggtctggagcttgatagacaccaaagttctcgattcgaagtccaccaggaacagtaacggcgggatccgacggagattttggccagtaatattcacatctttccggttcctttctgctggttagcatcacaatgtatggaacttcctcctgccaaaccattctccaaaaatcatcaacggtgttcttcattggagcttgagtcatgatgaactcattgaacagcggctttccagaaatccgatttgcgtgaatgaaatctccgagatactgaccgcgtgggaattggagagcgattcgagtggaatccctgcagtgaacacgtggattacggcacttttcctggttgttgtctgaagctgagtgagtgaatgggatgtggttgacagagttctcgaggatttcaaagcgtcgctccattcctccgatgatggttgacagatacttcgcttttctcgctgctccaaacatccgctttccgattcgaatgttgttgtagactgaaaaaaagttaattaattaaggaaaataattatttattttcttacactgtccagcaacacgaactcggtctctgtcagcaagaacatttgccttgaaagcttgaactcgcttttgcatcgtagaagcgtcgagttcacgaagtaggtattcagccagtgtctcattcttgacggcttctggatgaatatccgaaatccatgtgctggtttgatcatgtgaaagaaggcgcatcagaagcacctgatctcttgcggatttcagatcgatgcgatgatttgtgaagaaagttgagttgattccgaacttctcacagatgcttttcaacggcatcacccatccttgaccgttcactggacgctttggcttctttccattctcatcccgacgcatgtagatgtctgtgtatcgacccttccatttcgagtcgaactttgaagagaaaagcagctcttgagtgatctcggtgtcatcataacttgaacgaatcaaattagccattgcttcctttgtcaccttcttattgcatggagtaatcgatccaacacgggattctgcagaagctgcaattttgtaggctgcatgaagagagaaagctcctggcgattgatgattt
sjj_R12E2.10_21182aaatcatcaatcgccaggagctttctctcttcatgcagcctacaaaattgcagcttctgcagaatcccgtgttggatcgattactccatgcaataagaaggtgacaaaggaagcaatggctaatttgattcgttcaagttatgatgacaccgagatcactcaagagctgcttttctcttcaaagttcgacacgaaatggaagggtcgatacacagacatctacatgcgtcgggatgagaatggaaagaagccaaagcgtccagtgaacggtcaaggatgggtgatgccgttgaaaagcatctgtgagaagttcggaatcaactcaactttcttcacaaatcatcgcatcgatctgaaatccgcaagagatcaggtgcttctgatgcgccttctttcacatgatcaaaccagcacatggatttcggatattcatccagaagccgtcaagaatgagacaatggctgaatacctacttcgtgaactcgacgcttctacgatgcaaaagcgagttcaagctttcaaggcaaatgttcttgctgacagagaccgagttcgtgttgctggacagtgtaagaaaataaattattattttccttaattaattaactttttttcagtctacaacaacattcgaatcggaaagcggatgtttggagcagcgagaaaagcgaagtatctgtcaaccatcatcggaggaatggagcgacgctttgaaatcctcgagaactcggtcaaccacatcccattcactcactcagcttcagacaacaaccaggaaaagtgccgtaatccacgtgttcactgcaaggattccactcgaatcgctctccaattcccacgcggtcagtatctcggagatttcattcacgcaaatcggatttctggaaagccgctgttcaatgagttcatcatgactcaagctccaatgaagaacaccgttgatgatttttggagaatggtttggcaggaggaagttccatacattgtgatgctaaccagcagaaaggaaccggaaagatgtgaatattactggccaaaatctccgtcggatcccgccgttactgttcctggtggacttcgaatcgagaactttggtgtctatcaagctccagacccattgttccgtgtcactcatcttcgtctcattggaccggatcgcgaggaacgtcacgtggaacattg