Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R12E2.11   

sjj_R12E2.11 RNAi JA:R12E2.11
Simmer:R12E2.11:Repeat_b
Simmer:R12E2.11:Screen_A
Simmer:R12E2.11:Screen_B
PCR_productsjj_R12E2.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR12E2.11 Source_evidenceePCR684WS150 Sequence/Annotation Release
Overlaps_Gene R12E2.11 Source_evidenceePCR800WS150 Sequence/Annotation Release
Chunk_score Abs_score737
Max_abs_score737R12E2.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI41727334173730
Overlaps_transcriptR12E2.11 Source_evidenceePCR800WS150 Sequence/Annotation Release
WB_DNA_textsjj_R12E2.11998ttcttgttttatgtgatgcgatgcatgtgtgctaacaaggaagtttattggaatattatgaaaatgagaaaacaagttcacaaattggtagaatatggggtgcaacaatgaaatttttagaaaggtttagcaagatgagcaataatctcgtgctttcgttcctcggtcatctcgtttttcgtgatcaggccgtcgaggatcttctccattgtcaaaaagctgaaaaaatttgatttttaattaaaacgaaaaagcctcacctgaggaagttaagattatcttctgcgagattggcagttgctccctgttgtctatccaaaacagctatggcatcagtgaccaacagattctcattgcgaattgcttctgctgtctcacgaattgattcacctgatgtgacgacatcttcgacaagaagtactgtaccaccaggctgatagactccttcgataagttgctttgttccgtaggctttggcttcttttcttttcataagcatcggcacattgagaatatcagatacaagctaaaaacattgagtctcattttttagtgtgaattatttctgaaaactgacggtagcaagtggaagggcagcatatggtactccaacaacataatcgaatttgaggtttgaggcgacaattttctcacacatagcttgagcagccattcggagcacacgaggagagctcattattctgcgaagatctatgtagattggagtcatctggccagatttgaggtagaactccccagtgcgaaaacattccatttgatagagattctcgaaaaaatcagtttcctggattggtgaagcggcctggactttcatgacgactggatcctcgattgagtgatttccgttggcggtagcggtggcggcggtcattctgaatttttaacaattttcgaatatcaatgtgaaacaggttattttctttcaatagaaaagtgaacaaatatcacttggtcagatgaaccaggtacgtgatttg