Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R12E2.14   

sjj_R12E2.14RNAiJA:R12E2.14
PCR_productsjj_R12E2.14
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR12E2.14 Source_evidenceePCR225WS150 Sequence/Annotation Release
Overlaps_Gene R12E2.14 Source_evidenceePCR237WS150 Sequence/Annotation Release
Chunk_score Abs_score174
Max_abs_score174R12E2.14
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI41499404150575
Overlaps_transcriptR12E2.14 Source_evidenceePCR237WS150 Sequence/Annotation Release
WB_DNA_textsjj_R12E2.14636cctaaccttgggtataaaatggcaattggaaatattcaaaatagtgaaagacctagtcatcatgaaattcttctctgccgccgccttcgtcgccgctcttgttgcctctggaaacgcctgtctcggaggtggaggtggtgccggtggatgctgcccaccagctcagccaggatgtggaaacccatggtaagtgttggttggtgtttaataagtctagggatcccctgggattctagaaatgatagggagtgactggcgttgcaaccagaattttagactacaccgaaagctcttgtaaattttgttcagaaaaccctttgactagctttggaccttgtttattattcattcttataaaaacaaataagtaaaaactagtccaagtacagaaattgattttttttccgaaatgaatttaaatgccgttcagctatattttcagaagtttagttagtgttatttgataaaataatatttaaatacatatagatactcattacctcatattaacatcctaatttcagccaaggagccggaccacaatacgcagctgctccaccaccaccaccaccacagtacgctgctgcaccacaaggaggagcatacccaactgctggaaagtaatcagctcgaaga