Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R12E2.2   

sjj_R12E2.2 RNAi JA:R12E2.2
Simmer:R12E2.2:Repeat_b
Simmer:R12E2.2:Screen_A
Simmer:R12E2.2:Screen_B
PCR_productsjj_R12E2.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene R12E2.2 Source_evidenceePCR1073WS150 Sequence/Annotation Release
Chunk_score Abs_score1023
Max_abs_score1023R12E2.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI41793524180528
Overlaps_transcript R12E2.2.2 Source_evidenceePCR1073WS150 Sequence/Annotation Release
R12E2.2.1 Source_evidenceePCR1073WS150 Sequence/Annotation Release
WB_DNA_textsjj_R12E2.21177cggttgcggtgagtttttattttattctgagagaattatgttttaaattcgagtttttagaaccaaaacggacagaatcaaaaaacaattgagccaactcaagttgcccggcacgatgaagtttcaattccgctgcccccaatcactcgtccaccgagaaactttgccagtcgggaatgtggcgctaaaattatcgctgcaaatcctgaagctgagaatgctaaagctgttgtaaatgagaaagacgtcgatgattatatgagaaatccatgccaatctgccaaagaaaaatttatagttattgagttatgcgaagcaattcagattaaaaagatagctattggaaactttgaactgttcgcttcaagacccaaaacaattcaagttttcatttctgagagataccctcctctcgcaaattggatctctgttggaccatttcatctgcaggatcatcataagaatttgcaaacttttgatgttccaaacacaaatgtctatgcaaaatatgtcaggatcaacctagaagatcattatggaaaagaacattactgcattgtttcggttgttaatgtgatggggagtactttggctgacgaatatgacaaagaagaagctgctgctcatcttttaaatgtaattgaagaagtgaaggaagagccagtgacaactccgccaccatcggagcagaaaatgcagacacagcttccagtgccaccgaaatctccgaatcaaactgtttcagcacgaatgaaatcagtagagtaagttttctttccaaaaagcaccgaattaattattaatatttaatttcagcttccgtcaactgaaatcggtttgctcacaatgttctgtagggaaagtttccaacctcatatgccatattcttccaattccaacgagagtaaagaaaaatgatttagtcaagcctccgaataacctgaaaacatccacaattaagcctgcagttacggataagcgagacctcaagacagaaatcggattgtgggcagaacgaagtcggcattctaatttcgaacagtctaggagaagaaatttggcaacaatccaaagacttcacccgaaagatgtgcaaaaaatttccacagcacctgatgttccgacacctaaagctgaaaatatcgaaaaacccactgaaaagccatcggaagaggtt