Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R12E2.7   

sjj_R12E2.7RNAiJA:R12E2.7
PCR_productsjj_R12E2.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR12E2.7 Source_evidenceePCR249WS150 Sequence/Annotation Release
Overlaps_Gene R12E2.7 Source_evidenceePCR394WS150 Sequence/Annotation Release
Chunk_score Abs_score352
Max_abs_score352R12E2.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI41537064154587
Overlaps_transcriptR12E2.7 Source_evidenceePCR394WS150 Sequence/Annotation Release
WB_DNA_textsjj_R12E2.7882tgttggcaaagcagacatagttagtttttctttttgtcgagtcatcaaggaccgctaagcacgtaggcaggcattcttgtgcctatgtgaaaagttttgattttctaaacttggcagtgtgccgcaactttataaatgccacaaaagctgggtaagcttgatttaaaggctgttaaagttgctaaagtttgcgctgaggattctgcaaaatgccgagtaagatccattccggaattcattttaaatttcagcctaaacattgaatgcgattttttatttgagtttagaaaaaacaatgaaagacaaaaagttaaactttttcaaaatatacagaaaaagaaggttcttagttcatggcatcatttacttctttccggcagttgggtatccaccggctggtgcagcgtaggctggtggtggagctgcgtatgatggtggagcaactgggtaggcggctgggccggctccagctggaccaagacctcctccgctgaaattgtatatattgaatgacaagttatcaggtaagaacagacaaaagtcttttgattctagatccccaagaaatcccaacttaccatgggtttccgcagcttggctgagcctgtgggcagcatccaccacctccggatcctccgaggcaggcgtttccagatgcaacaagtgctgcgacaaaagcagaagcagagaagaatttcatgatgattgagatgtgttgaaaccaaacttggtatgccgaactgatcccattttgttcattttatagtatccacttttgaggcagcgcaagggcgggatctaccacctgccgttggcattcgatggccttcagcttcatctcccaacgtcttgatctcgttacctgttgtattttgaatgggc