Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R13A5.13   

sjj_R13A5.13 RNAi JA:R13A5.13
Simmer:R13A5.13
PCR_productsjj_R13A5.13
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene R13A5.12 Source_evidenceePCR1039WS150 Sequence/Annotation Release
Chunk_score Abs_score997
Max_abs_score997R13A5.12
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII75737837574920
Overlaps_transcript R13A5.12.1 Source_evidenceePCR1039WS150 Sequence/Annotation Release
R13A5.12.2 Source_evidenceePCR1039WS150 Sequence/Annotation Release
WB_DNA_textsjj_R13A5.131138ttgcttcacattcgctatgcttccacatactcgtgttctcaaagaaggaatgattgacagttgccgaaaactcactgcggagttcatgcactatgtgattgaatcgcaatctcttcgcaataccttcatctcgatcaagggaatttactatcaagcggaggtacatggagagaaaatcacttgggttgttccacacgagcgtggtcttccacatgtcaccgatgttgatttcacagtcctcgtgactttcgtcgagttttacattgccatgttggggtttgtcaatttcaagctctatcaagacatcggactcttctacccaccacagatcgggcaagtcgtgaaaactgatgaaatggagactgaagaatacaaagaaaaggtgtacagtttggcgaaaccattggctaagagaaaggatgttgagcaggctgaagacgatgagccgttggaccttcttggtgaagactctgatgcactcgcgcaaaaagtcagagaagcaaaaagcatcaagactatgttcaaaggttgcgttttctacttgaatcgagagtgcccaaaagaagcactcacttttattattcgtaatggaggtggaattgttggatgggaaggaggccctacagatctcaaggccgacagtaaaaatatcagtcaccacgttgtcgatcggccaatggacaagctggaggtgaatagactttatgtacagccacagtgggtgttcgattgtctgaatgctcgcaggaagctgcctacggaaagatacatgccaggagtagctcttccgccacatttctcaccatttacatctgagaaggctggagactacattccgttcgaaagattggaagaactcagaagcatgggcaaaggtgtgttttgtttttacttttgtgtagtattctatcttttcaatctgatctgaaggaacgagatattaaattcacgtcctttaataaaatattgttcagacgtgtctgatctcgaagcagcaattccgaagacgatggacgagttgccaatgcgaagaaaggaggtgaaaccagaaaaaccaaagggtattcacattgctgttggtcaaatgcacaagaagagcaaagagaagttccacgagactgtcgagaagggacaggag