Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R13G10.1   

sjj_R13G10.1 RNAi JA:R13G10.1
Simmer:R13G10.1
PF:GL1_8E12
PCR_productsjj_R13G10.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR13G10.1 Source_evidenceePCR836WS150 Sequence/Annotation Release
Overlaps_Gene R13G10.1 (3)
Overlaps_transcriptR13G10.1 Source_evidenceePCR836WS150 Sequence/Annotation Release
WB_DNA_textsjj_R13G10.11096agtttggaaattggtgcgacaaaacgattggttccaacaatatcctcaatatattcaagcattccttcttcattcggatttttggatgttggcttcattagtgcaatcgcttcaacttctccttgcagaatcaggaatcgattatgggtcatatcaattccagcacgtaggagaagctcctggacgtctttttgcgatgcatctttgtcatcaatacgatattttgaattgttttcacgatttattgtgcgggtgatgcagacgcaattatctgttaacacttcatatttatcgtaattttcgacaggctgaaaattaattttgatattgatagttattagtttgttttcaatcgtgtggatctcaggcccgctttaataacctacttaccatatccttcaccatctggaacataattgttactgaacatgattcgtagttccctcctgaattgatcaatgctgatagcttcttggtacgaatttttccagcctgaaacaatgtatattgtggaataaaaatttcaatttaaaaaactcactttaaatccaaacacgaatagcaatgcatcaataacgtttgactttccacttccatttggtcccaggatcattgtcaagttcttgtgaaacggtccgagaatatgttttccagcataacttttaaagttctcaacgtagatattcagaattatcattcgatttccatccggatccgagatctgatcttcatattttgggggaatttgaacattcaaaagatcctctttttcatcatatttcacaccgttttcagccgcttcaagttccaacatatacgcgcctgaactaacatcatcgaatatgttgagctgttccatgtactgtcgtcggcgatccacgtcgagatcgacttcaggcatcgagtcggtgtcagcatatggtctatcatcgtccgaggttagcgcccgtcttttaaacggctgcatacctgaaaaaaggaattaattttgataaatattaaaagggagagggagagtaagaggtgcataattttgccaaaaaggcaaagctttggaaatgttttgacaactggcaaactttcgaccccttccaat