Oligo: sjj_R13H9.4_f
| sjj_R13H9.4_f | Sequence | GCCTTCTTATCAAGCCTTCTTTC |
|---|---|---|
| In_sequence | F36H12 | |
| R13H9 | ||
| PCR_product | sjj_R13H9.4 | |
| smd_R13H9.4 |
![Adult](JavaScript:void
window.open("/cgi-bin/rnaidb/popUpImage.cgi?imgName=N2wormfinal.png",
"RNAiDB Help","toolbar=no, location=no, directories=no,
status=no, menubar=no, scrollbars=yes, resizable=no,
copyhistory=no, width=1000, height=550"))
 |
Please provide feedback if you are experiencing any difficulties with this website. |
| sjj_R13H9.4_f | Sequence | GCCTTCTTATCAAGCCTTCTTTC |
|---|---|---|
| In_sequence | F36H12 | |
| R13H9 | ||
| PCR_product | sjj_R13H9.4 | |
| smd_R13H9.4 |
|
Please provide feedback if you are experiencing any difficulties with this website. |