Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R31.1   

sjj_R31.1 RNAi JA:R31.1
Simmer:R31.1
PCR_productsjj_R31.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR31.1 Source_evidenceePCR2164WS150 Sequence/Annotation Release
Overlaps_Gene R31.1 Source_evidenceePCR2164WS150 Sequence/Annotation Release
Chunk_score Abs_score2101
Max_abs_score2101R31.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1190949411911757
Overlaps_transcriptR31.1 Source_evidenceePCR2164WS150 Sequence/Annotation Release
WB_DNA_textsjj_R31.12264gctgaaatcattgctaatgaaccacgaattcagcaaatcaacagtgaaggagatggtttggtgtctaaaaaacactacgagtcaccaaatgtcgaaaaaattgttcggcaagtcaatgctcaatggggtgatttgaagaaacaagtttggaacaagggacttcgccttcgtcaagccgctgatcaaaaaggacttgatagaatccttgaagatgcacacgctaagctagatgagatgcaaactgctctgaactccaaagatcaagggcttgacttgcgatcggttaaagatttactccaaaagcacgctgtactcgagcaggaaatgggactttacggaaataaggtttgttgttaaaattagcttataaaactattgtttctttaattttcagctttctgatattgagaatcgtggaaagaagatggctgtagatgggcattacgatgctgatagaattcattcaacagttggtcaacttcttcaacgatatgctgcaatgaagggtccagcacagcggagaaagggagatcttgacgaatctcgtctttggcatcaactagtttttgatgttgactgcgaattacaatggattgctgagaagaagccaattgcttcatctcaagattgcggtcgcacgcttaccgaagctttgaacatggtcaagaagcaggagcaattagaggctgaagtcaaccaacatggcggacagattgataaagttcttctgcaagcgggtgaactgatcaagagacaccattctgcctcatcccaaatcaaagctaaaagctctgaacttgaaacagcttggagtgaattgaagaagcttctacgcttgagacgtgccgttgttgactggggagtgaaggaacaacagtacttatttgatgctgctgaagtcgaatcatggatgaacgagaagcgaaatgcattggcatcggaagattatggaaatgatgaagatgctgcacgtaaacttctgtcgaaacatcgagctctttgtgaagatatgactacttaccgtcaatggcttgagaagttggaagtaaagtgtgtcgaactcgttgaatcaaatcgtccacatgttgaacggttccagaagagacaagatgaactcgttcgtgaatttgatgctttgagcaagctagctgaagatcgtcgcaacgctttggaagatgccgtttgtctgtacgagtacatgagggaatctgctgacttgggtcaatccatcgaagaaaatttgcgagtagctatgagtgaggagtttgctgaggattatgaacacttgaaggagctgcaatcgaaattcgatgagttcaagcaaaaagtcaaaaatggaagtgaacgatttacatcttgtgagactgctgccaatgctattctccgacgcaatccacctttcgcaagagatgttgtcaagaagcaggaagcactcagaaccgcatggaacacactgtgtgaatacatcgaagcacgtgattcgaaacttgccgttgctgaagagcttcatcgattccaccgtgacgttgacgagtttgagcaatggatggcagacaaaatggccaacatgccacgtgacctcggtcgagatgtgaaacatgttcattctctatggcaacatcatgaagctttggataaagaaattcataattctcaaccacgattggcaaagctcgtcgaggaggctgaaagattgaagaaaacatacccaggtggaaacgcagaacagattggtggaagacaacagacgcttgagcaagaatgggaggagttgaaaaatgccacagatgacagaaaggatatgctgagagcagcatttgacttgcatactttcaatggaaaagttcgcgatttgcttgcatggactgatttgaccatcagtgatattcaatcagatcttcatatcaatgatctacaacaggctgaatggcttcagacagagcactcaaggtaataatatttagaaaaaagcagttcacaaataaattgtaaaattttcagattgagtcatgaaatggatgctagagagccagagtttgcacgacttgtcaatgacggagaaaagatgatcactgctcaacattacgcgtcggaagagattaagaacaaaacacacctgctcaaatcagctctggaaagacttcgaagtgaatgggctctcagaaatggattcttgtcacaagccgttcaatggcatgccttccaacgtgaagctaagcaaattattgcatcgattggttccaagagaacaactcttcgcagtt