Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R31.3   

sjj_R31.3RNAiJA:R31.3
PCR_productsjj_R31.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR31.3 Source_evidenceePCR1209WS150 Sequence/Annotation Release
Overlaps_Gene R31.2 Source_evidenceePCR62WS150 Sequence/Annotation Release
R31.3 Source_evidenceePCR1249WS150 Sequence/Annotation Release
Chunk_score Abs_score1060
Max_abs_score1060R31.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1192718011929355
Overlaps_transcript R31.3 Source_evidenceePCR1249WS150 Sequence/Annotation Release
R31.2 Source_evidenceePCR62WS150 Sequence/Annotation Release
WB_DNA_textsjj_R31.32176tttcaattgtgcccactaaaatccaaaacgtttttttttcaacatgaatattttattatcttatctccagacaaatcaatcacaaatcatcgaactcatcaatatcagagaacagctgctcgtccatctcttcgccttgattaaaactttgatgatgagcatcatgctctccaatatcgaacgctgatgcaacttccaactctccatccatcattgaacgtttgaataacatgagtttgctcactgccaactcaattattttcttgggggttcgttcacttcttgtcaattcagcagatattccagtaatttcaccagctttttcaataaagaatatgagatcttcttcctcgcctgaaactattccatttattattttttctgaataaaaactcttacttctatttgcgagctgagaaagttgaatttccggagagctgaactgttcatcaagatcaaataattcaagaggaggcattggtaattcttgaaatgttggtggaaatactgcaggttgaaatggaggcattggaagttcaaattgaggttcaacaagggtaagtggtggaggtgaaagattcaatgcttcatacaatctagaataaaaatgtttattcaagtagaaatgatgttttacactaaaacttattgtaaacttcattctaatattctttccaaatatcgaaataatttcaaaagaaggacgcggaaacttgcgcctttaaatgctaaaaatttaaacagtactgtagtgtgacactactcattattctcttttgactattagaaaacagagtgaggtactacggtagttgttaaagtcgcacgctcttttccgtactttattcgtaaataatttgatcgtgtcgagaccagctaccgtattttcaggaaaacatcgcaaagttggtgattgggtaaaaccgtgtttccattttcgaaagcatgattcttgaatctttttcttagtaataacaaacatatttctgtagtcaggggaaagtatttagggcacagtaccttatagtcattggccaatgtttcaaattaaaagaatgcaacgaagtatccataatcttcatgaaatccgaactgattgcctgatccaattctccttcgtacatacaaacctgtttgttagtttgtctagaaagtataattttttgaagtcaaaccttgatctgctgggacatatgaatatgatctggaatatttgtgtaatcattaatttccggctctgcagcatctatcgtgttcagttcaagaccattgaccaggaattccacaaatgtatcctgaaattgaaattttccaataaggcgagttaagaggcgggtgggaggcgcatcctgcacgcctcaaccaaccggggaagtttatttcgaaccatatcaaaaatacacttacaaaaatctttccattttcttccttatcgatgtatgtgtcatgaaacatcgagactgatccaaccacacacactctacctttctttttctgaaaataatatgaattaatgtaccaatttcagaatattctaataccatttcattgagttttgtctcatgaaaagcggcaactgggcgacttgttggaaaacttgtacttccagaagacaatactacattcgacatacgattattcacatctagagtacatccatatggataaatgaatgaaagtgctctgaaatattgaaatcacttttttatttttggaaaatcggaaaccgaattttgtcctaaataaataaaaagctaatagttcaactcactgtgaattatgtttttgctcagtgctcacattcttttttgcagccactgcaattgctcgatttatgactccatttgctactaaagcttctttcggatcaaaatatttcaggaatacagtacgaattaccgaatcttgaatgttgatgatttttgtaattcatttaatttgataaagacatacccttattcacagtaattccatattttgcaatcatttcatttaatgattgtctctcaccaccttcaccagaaaggatcatcaatgaaccaccttcttccacaaacttccatattgcttcaatcttaaattttaattttttgggtgttaaaattaggctgagacaatcaaatgaaatttaataaaatttaaaatcctaaacctctccagttccaaatgatgtctt