Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_R53.8_b   

sjj_R53.8_bSequenceTTCCCAAAGTGCTTTTATTTTCA
Length23
In_sequenceSUPERLINK_CB_II
PCR_productsjj_R53.8