Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_T01B7.1_f   

sjj_T01B7.1_fSequenceGTCTGTGATTTCATTCGTCATCA
Length23
In_sequenceSUPERLINK_CB_II
PCR_productsjj_T01B7.1