Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T01C3.6   

sjj_T01C3.6 RNAi (2)
PCR_productsjj_T01C3.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST01C3.11 Source_evidenceePCR255WS150 Sequence/Annotation Release
Overlaps_Gene T01C3.11 Source_evidenceePCR255WS150 Sequence/Annotation Release
Chunk_score Abs_score213
Specificity_index0.294
Rel_score0.417
Map_statusBottom50_percentile_ePCRV1500226815003205
T01C3.6 Source_evidenceePCR532WS150 Sequence/Annotation Release
Chunk_score Abs_score511
Max_abs_score511T01C3.6
Specificity_index0.706
Rel_score1
Map_statusBest_ePCRV1500226815003205
Overlaps_transcript T01C3.6.2 Source_evidenceePCR481WS150 Sequence/Annotation Release
T01C3.11 Source_evidenceePCR255WS150 Sequence/Annotation Release
T01C3.6.1 Source_evidenceePCR532WS150 Sequence/Annotation Release
WB_DNA_textsjj_T01C3.6938tgccaatatttcaggcagactattcgtcatgtgaaatgttcaactcatgttgtgattttcgatgtagtcgtgctcggcagaagagatcaacgtgtacaataaacggaacgggaatcagcgaagttcaaactgagtgcatttggtgagtgtttctataccataccagaataagattgaattttaagctctaaaccaatacaacaattcgaagttgcctacacgagaaaaactaaacactcaagattggacctcatcgccggaatactattcatttttgtccttgatatgcttttgctcagcttcactttctaaatctttttaaattcgatctcataaatcttttttttcaataacaattttattgtgcaacaaaaagaatttaacggtaagacttctggtagcgagcgcgggctcctggtccaccgaacttcttggactcacggcgtcttgggtcagcaaccaaaagggacttgtcgtaagcggcgaagatgttcttcaattctctcttgctctgctcgtcaacgtacttgtggtagtaggcaacgagagccttggcaagggcttgacggacagcgtagatctgggcaacgtgtcctccaccgctaacacggattctgatgtcgacatcctggaagcgttcctttccgacgaggagaagtggctcctgaaaaatacaagttagttggaatttaatgtcggaacaaaaacctgaagcttgatgcgcaggatctgtggctccaagaactcaagtgggcgaccgttgaccttgataagtccttgtccctttttgcagtgagcgacagcggtggcagtcttcttgcgcccgaaggtctgaaccgattgcacggtagacgtcattaccctgtaataatatattaaacaaagaacaaaataaaggttacaattaaagtagaatagaaatatcggcaaggttgaga