Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T01C3.7   

sjj_T01C3.7 RNAi JA:T01C3.7
Simmer:T01C3.7
PF:GL1_4E11
PCR_productsjj_T01C3.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T01C3.7 Source_evidenceePCR778WS150 Sequence/Annotation Release
Chunk_score Abs_score716
Max_abs_score716T01C3.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1500341315004266
Overlaps_transcript T01C3.7.4 Source_evidenceePCR778WS150 Sequence/Annotation Release
T01C3.7.1 Source_evidenceePCR778WS150 Sequence/Annotation Release
T01C3.7.3 Source_evidenceePCR778WS150 Sequence/Annotation Release
T01C3.7.2 Source_evidenceePCR778WS150 Sequence/Annotation Release
WB_DNA_textsjj_T01C3.7854ctcatacggctccagggttacctgctcaagtggcttgaacttctcctccttcagcttgttgacttcaccagcaaatacagcctcgggctcagcagtactgtcaatgcaattagctttgatagagatgacggcatgtccaccgttgcgaaggaagttttgggcattgagagcaacaatacgagcttgatctggctgagcaacatcagaaaagatgacatcgaccattcctgtaatataaatattaaacacaaaaatgcttaaatttaatacttaccgacaagcatgcggtacttgtgtggatgtctggcatcttcgacaattgggacaacgtttggtctcttcttggcaactcccaaaaggtcacgtccagatctgtgagagaactcaacagcataaacgattccttctggtccaacgacgtcagaacaatgggaaacagtagttccagaagcagctccgagatagagaagtttggttcctggcttgatgtgagtgttctccaatcctcccatgatggaagcagcgagcttagaacggaatggattccacacacggtactcgattgagccagctccgtcatcgacggacactctcttctctccgtacacggactctcccacaaccatgttctttgtggcaagagcatcttcctttcctttcacgatgaatactccaccgagacgatgtggttcgacaacgacagtctttcctcctcgcattccaccggctcctccgcgtccaccacgtggtgatcctcttccgcctcttggagatccacgtcctccgaatcctcctcttggtgatccacggccaccaaaaccacctctgaaaaattatcgttttgatggcgaaca