Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T01C8.1   

sjj_T01C8.1RNAiJA:T01C8.1
PCR_productsjj_T01C8.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS (2)
Overlaps_Gene T01C8.1 Source_evidenceePCR882WS150 Sequence/Annotation Release
Chunk_score Abs_score777
Max_abs_score777T01C8.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX1679983616801378
Overlaps_transcript T01C8.1a Source_evidenceePCR876WS150 Sequence/Annotation Release
T01C8.1c.1 Source_evidenceePCR876WS150 Sequence/Annotation Release
T01C8.1c.2 Source_evidenceePCR876WS150 Sequence/Annotation Release
T01C8.1b Source_evidenceePCR882WS150 Sequence/Annotation Release
WB_DNA_textsjj_T01C8.11543tcatttgctgcaacttcctggcaacaccataagctgccaaattgttgcaaaaattttgtcccaatctgccaaatactgacatatttatctttcttttctgttcatctagttttcacattttcagttggaatccatgagacaactcaatacaaagtggctgtcaagattctgaaccgtcagaagatcaagtcactggatgtcgttggaaagattcgccgcgaaatccaaaacctctcgctcttccgccatccgcatatcatccgcctctaccaagtcatcagtacaccttctgacattttcatgattatggagcacgtttccggcggggagctctttgactacattgttaagcacggacggctgaagaccgcagaagctcgtcgcttctttcaacaaatcatttccggcgttgactactgtcatcgtcatatggttgtccatagagatttgaagccagagaatttgttgctcgatgagcagaacaatgtgaagattgcggactttggactttcaaatattatgacggatggtgacttcttacgcaccagctgcggatcgccaaattatgctgcccctgaggttattagcggaaagtgagtgattatggtggtctcctgatcatggttcaatgtaaaataaaaaccaaattagaactgaataacaaaacatgaaacatgtgttcgcaaacaccaagacgacattttgcactagtagaaatccaattaaagtaattgaacaagattagacacaacaactttgttttgcaggttgtacgcaggtcccgaagttgatgtatggtcgtgtggagtcattttgtatgcacttctttgtggaaccctgccatttgatgatgagcacgtgccaagtcttttcagaaaaattaaatgtacgttagtgtgacatgagaatcaaaacacaaaaatggcaaaggattacgacaacataccaatttcatttagacatatgaaagcgaaatgggatttgaaaattgaaatatccctattacaaaaggcactattactatgttttggcgcactgcccgggtgataaatgtttgaaatttaaattggaatcattaaaaattataacgttcacgaaatatgttttttagctggcgtattcccaactccagactttctggagcgcccaattgtaaatctgcttcaccatatgctctgcgtagacccgatgaagagggccaccatcaaggacgtcatgtaagtggtcttctaaaaagaaaaaaaaaacaaacatcgttgctatgagacgccaaggaaacaagacaataactgctttatattttcagtgctcacgagtggttccagaaggatttgccgaactacttgttcccaccaatcaacgagagtgaggcttccattgttgatattgaggctgtccgagaggtcactgaggtattaatcgtgttcgataggagcagaagtttctaatcacaatgaaaagtttcagcgctatcatgtcgccgaagaggaagtcacctcagcattgctgggagatgatccacatcaccatttgtcgattgcat