Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T01D3.6   

sjj_T01D3.6RNAiJA:T01D3.6
PCR_productsjj_T01D3.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS T01D3.6a Source_evidenceePCR801WS150 Sequence/Annotation Release
T01D3.6b Source_evidenceePCR801WS150 Sequence/Annotation Release
Overlaps_Gene T01D3.6 Source_evidenceePCR801WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRV1372182313722742
Overlaps_transcript T01D3.6b Source_evidenceePCR801WS150 Sequence/Annotation Release
T01D3.6a Source_evidenceePCR801WS150 Sequence/Annotation Release
WB_DNA_textsjj_T01D3.6920atggataccgtggagatggatacaactgtactgatatcaatgaatgtgttgagactcccggaatttgcggacatggacaatgtgtcaacactcctggatcttaccactgcacctgcgatgacttctggctgggagacaactgcaacacctacaagccacgtcgtcactgtgccgatttgtatgtctactggggagtcagagaaagtggtgttaactccatcaatccaccattcgttcttccacaaagagctaagtttgctccaatgaatgtttattgcgacatgacaaccaacggaggaggatacactttgatgtcttcagatactgcagatttgaatactaataagacattccaagtgagtactaattccaaatttgtgaattgattgtgagacaaataattttaaagtgaatttttcaggactacttgatcggattcggaaatccagcaactcaatctgtgtggcttggactcgagttcattcaccaacttaccacctatcagccacaaaatcttcgtttgaacctcttcagatgtgccagcaacggacgcccatcccttactactgattgtacatacccaacattcagtgttcttgactctaccactcaatactctgtggtgatccgtgaggcttgtaccggatctgaagctgatgagcattactatcaagatggttgggcaagatgggatttgactcagaatggaccaaagttctccacctgggatattgaagcacagaccacaattccaccaacattgagagccaagatggagggcgatgcaagtaagttttcgagctataacttttcaaatttcctaactaataatgcattttcagtttactacacatgttccaagtccaacttcaacactggatggtggtatgtcgaggatcaactttgtggagctgccaact