Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T01G9.3   

sjj_T01G9.3RNAiJA:T01G9.3
PCR_productsjj_T01G9.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST01G9.3 Source_evidenceePCR725WS150 Sequence/Annotation Release
Overlaps_Gene T01G9.3 Source_evidenceePCR887WS150 Sequence/Annotation Release
Chunk_score Abs_score803
Max_abs_score803T01G9.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI82833728284564
Overlaps_transcriptT01G9.3 Source_evidenceePCR887WS150 Sequence/Annotation Release
WB_DNA_textsjj_T01G9.31193tggcctacaaccacatcaaattcatcccggtacagctgccgtctcgctattaccacctgatttcattgaacatttccggaaatgaattgacttatttgcctgacaatatcaacactttgcttccaaatgtgaaagtatgtccattttctatacgaaattcgaagcgtttgtggacccccttatatggggacacgcatgtcatttgaaacctgctcactgagatttctttagactttcgacatcacagccaaccgattccacaccttctcgcatacagatttggcattcctaaataatgttgaacaagtgtacgtagatggaaatccttgggattgttcatgtgctattcaaggacttcaagtgagtcttttcctctcttatttctgaattaattcgaacatcttttcaggttcatatgcgagatcgttatgcgatgagacacattctcaactacgataatgtccgatgcgcgacaccatcgcttgtggaaggtcattcagttctggcaattaccgacgtaagattcacattcacgttattaatttcactatttaaaaacttcaggtaaacgactgtgccgttttgtttggtgcacggtatggattaacgcaaacaagtgaaatgctcatacttctcgcaggagttctcctttttgccgcactacttcttatgattcttggatgcatctatttccttcgtgagcgacagtacaaaggatcatatgtgacacgagaacactctcgaactccactcacgatggcaaacacacatagttgctcttcgagtacaaatgatacacatggtccattatcaccaccatttgatccattcttggttagtactgaaacatttaaagccactcctccattgattccaccagcacctccaaaacctggatcatcctattttggcatttaaatatccttttgagagtttcaaatgtttcaaaaatctaaatccgtgtgattatttgcatccatctagtcgttcgatctcccagccccattttcatgtatttttgccccctttttcgatacggtgttcaattgtttaaccctttgtctgtaaataaaataaactgctcgtagatataccaagttcaatgaaatagacaggagccttaatcagcagcataatagtagttttcaagaggtaagacacctcttctcggccgtaaatccgtcggcaaagaa