Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T01G9.5   

sjj_T01G9.5 RNAi JA:T01G9.5
Simmer:T01G9.5:Screen_A
Simmer:T01G9.5:Screen_B
PF:GL1_1F2
PCR_productsjj_T01G9.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS T01G9.5a Source_evidenceePCR1070WS150 Sequence/Annotation Release
T01G9.5b Source_evidenceePCR1070WS150 Sequence/Annotation Release
Overlaps_Gene T01G9.5 Source_evidenceePCR1070WS150 Sequence/Annotation Release
Chunk_score Abs_score1007
Max_abs_score1007T01G9.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI82949528296117
Overlaps_transcript T01G9.5b Source_evidenceePCR1070WS150 Sequence/Annotation Release
T01G9.5a Source_evidenceePCR1070WS150 Sequence/Annotation Release
WB_DNA_textsjj_T01G9.51166gatggaatgaggctggtgatcttcttcgtcagctcatgacagatgtcaaaagctgtaaaatttcggcaagcaacagagacgagcatgacgcaagaaatgtacgtaatataaatcttttaaaagcttgttgaattatttgaaatttcagacattcctacgagccctagaggctaatttgaagcttgtccaacaaaatgtgcgcgatgaagatgacctacacgaggcgatgacgcgacaaagtggaagtccagagccacctgcagacccagatgtttggtccaaaccatcgccaccgttaccatcctcatcgaaatttggagcaacaaagaaaggagttggagcagcaggtccacgtcccagagaaatatcaaagtcaacgtcgtcgatgagcacgaatccggctgatgtgaagcctgcgaatccaacacaaggaatactgcctcaaaatagtgctggagattcattcgatgcatcggcttatgatgcggtaagttattatgttttccagaaacaaaaatcagaaatcttttcagtacattgttcaagcggtgcgtggtacaatggctacaaatacggaaaatacaatgtctttagatgatataatcggaatgcacgacgtgaagcaagttctgcacgaagccgtcactcttccactcttggtgccagaattcttccagggtctccgttcaccatggaaagcaatggttctcgctggaccacctggaactggaaagactcttatcgcacgtgcgattgcttcagagtctagttcaactttttttaccgtttcctcgactgatctgtccagcaagtggcgtggtgattccgagaagattgttcgtctgttattcgaacttgcacggttctatgctccatccataatcttcatcgatgagattgacacacttggtggacaacgtggaaattctggagaacacgaagcgagtcggcgtgttaaatccgagtttctggtacaaatggacgggtcacagaataaattcgattcgcgacgtgtattcgtgctggccgccacaaatattccatgggagctcgatgaggcactccgaagacgtttcgaaaagcgaatcttcattccactgccagatatagatgcaagaaagaagcttatcgaaaaatcaatggaaggaactccgaaatccgatgaa