Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T01H10.6   

sjj_T01H10.6RNAiJA:T01H10.6
PCR_productsjj_T01H10.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST01H10.6 Source_evidenceePCR893WS150 Sequence/Annotation Release
Overlaps_Gene T01H10.6 Source_evidenceePCR893WS150 Sequence/Annotation Release
Chunk_score Abs_score767
Max_abs_score767T01H10.6
Specificity_index0.588
Rel_score1
Map_statusUnique_ePCRX1212225112124966
T01H10.5 Chunk_score Abs_score468
Specificity_index0.359
Rel_score0.61
Y51H4A.6 Chunk_score Abs_score70
Specificity_index0.054
Rel_score0.091
Overlaps_transcriptT01H10.6 Source_evidenceePCR893WS150 Sequence/Annotation Release
WB_DNA_textsjj_T01H10.62716accaaaagatgatttcctcacaataggaatacaaaaaatcggttgcatgcgctttccttccattaaaaccctttatagtgcaaaatatttttagcaatggtatgaccccagactctcctggaactcctcgttatattccaatattccaacagttttcgtaagacaggaaaaagtgtggagtccgacattatcggcatttggagtgtaagggttgtaaactaagtatccaaacaaattttctaattctagaaacgaaataattgacttccgagatcaagattttcggatagtatccattgacgatataggttatatccaggactatttgtcagtgcgagtgtcatcaaattgtccaatggatgtttccagattcccgtttgattctcagacttgtcaaatttgtttttgtttacctatattcaacatacggcaagtcaaaattctcaacgaaatttatgaaggtatcctgcaagaaaaaataatcaaaactatggtaagaattcacagtgatcacgttctgcgcctggcgcgcgataataagggaatccgcctggcgcgcgtacctcaagcgcaaagggcgcgctcgaggcgcgcatagtatgcgctctgaatgcgaatagagtctggcaagaacgaagcagaaacaagaaaataaaataaacgtgattttttctgaactttatagactaataactatgtaatcaagagtatgaatgagtaaatgttcaaaatggaacttttattggctcgaggttgcagttgtcaattggtacacaattaataggaaactatggtgatatgtttgtgtatatattgatccgtatataagaaagtaccggcatataggcaatttatagttgttttgacttcccaatcctcaaattcacgtagaaaaaacataatcctcacatcgtcgacgctctgtgcgcggatcgttcacactctgtacgcgccccgtgtgcgccccgtgcgcacgccctccgccaatcgcggccgcggcctagatttcaactctgccaaatttttcaagctgtgttttttttaaagtttttttcgactttacacattttctatattttttatttatttttcaattaaatattaatgaaaaaatttgcagaaaatgtacaaatgccggtacgaaacaaatcattggaggattataatgaaagagttcatcggtaagattataaaaagaatttattcgaaataagtaataatttgataacgatccggtcttcaaactcttctatgcatcgtatttatttaaaaataaacagaaattttgtattttcagaaaagcagcaaagtatggagacgatttggattcaccacctcctccgacagcatatgcacgagagacctttggaaaaaagatttttggagttgtatattttcccaaatacttgtaagtttttcttcttcaaatgaacatgaaaatgtttcgatgaatgaaattaacttctttctttttgcaggtccatcggaagaacttgaggaactccaacagaaaaagaaggggactcgctacacaatggaagtttttaattttgaagtgttaattttttttaaaagattttcaatttaataaaataaaatttaaatacaatcagtattccaagttgtcaatgtattttataaaataatgaagggatggggaacgagccgtggccaaatccgtatgaaatgcgccgggcgctcgcagagagtgcgccgggcgctcgcgacattattactagcgcgctccgtccgcgcgcccggggcgaaacgtgcgcgcgccaggagtagcaaagtgccgagtatgtatacagggaaactccgaatggaaagttgtcagtcttactaatcgtgtggagcagctgaagtatgatgacgattacggaaatatggatttggtgggttgagtgaaaaataaattacaaaaattgaaagcacaaattcaggcagtttttgaaattacaataagaagaaatccactgtactacatctacatgatagttttcccttcttttgtcataaatggaatttcaatagttggtattttcttgaagagtgccgacaaaatgtcaaaggtaatttttttcaaagtttactgaaagaacccaaaagtatctaaacacttttgtcacatattttttcatatagacaacttgttcttcaaagctttcttaatcaattctattgattcacagtttaaaaattctcagaacatcatttttttttctctcaaactttgcattcatgtttgatgaaaattgttgtttgatgaaaaaaaaattgtaaaatttttaaacaaactagaaaaaagtgaaaaaaaattatagtcatgccatgttttcagcttaacgttggtctcacaaacataatgaccatgacatttatcctcggagtgatggctgataagataccaagaaccggaagcattccattacttggaatttacattattataaatcttctaattatgataattgccattacagttgttgttctaatcactgaacttcgccaatgggctgtgccccggctcaaactcaagaagagctacattaggtgattcggatcaaatattccgtgcgaaaagtaacataatttatttcagcaggaagctagaaacgtttctgggctcgccaattgagtacacctgtgcaattctattggagtttctgacaaccgctaatttcttcgttattattggattttggtttgaggattt