Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T01H3.1   

sjj_T01H3.1 RNAi (2)
PCR_productsjj_T01H3.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T01H3.1 Source_evidenceePCR800WS150 Sequence/Annotation Release
Chunk_score Abs_score716
Max_abs_score716T01H3.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII78782047879374
Overlaps_transcript T01H3.1.2 Source_evidenceePCR648WS150 Sequence/Annotation Release
T01H3.1.1 Source_evidenceePCR800WS150 Sequence/Annotation Release
WB_DNA_textsjj_T01H3.11171cacagtgtgtaagagaaaaggggctcaagaaaaatatacattcgttttgaaaaatatgagagcagtggcggagtgactggattgatgctctatggaactagaaaaaattactaatttttgaatggcattgatttatttgtttccgaatgaagccttgttagtctgaacaattccgatgatcattccgaagagtccaatagcggaagcgaaaatttcaataatgagaatcttgacgaaaagagctggattggcggcatcagcaatggcagctccagatccgacgattccgacagcaagaccacagacaaggttggagagtccgacggtgagaccacctccaaagatcatgtatcctgaagcgaggttacgagcaaggattgccattccgtcttcagtatcaggaagatcttcacgacggaattcctgaaaaatcattccatgtttttttttctaaaactttttaaaaattaatctttaattgtaatttttttacaagaaagctgagtttcaaaaagaaaacataaattttaatttgtaataatagtttctgaaacttacagcgagctttccgacgaacacgaaagccatgataataccgaaaatagcaacagcttcgcagaaaataatagaaacaagattctttgttctaattcttggtgccttaactcctcctccgagaattgaagatcccgttgtgaagattccccttaaaaagcgaattatttttattttctttcaaaaaatgaaaaattaccatccggctcccaagacggaaagcgaaagcgagaatccgataccaagaccagcccacatatgtggtgatgtcgatgtcaagaaccatccaatgtcaaatcgatgtccttgtccactgagcatgtaaaacaaccctgaaattaattttaatatattaaaaacatttgatatctttttcatttatgggaaattaaaaaaaaatcttacctgttccaagaatgatcagggttgtgattaccgtcaaggtagcagtcgtttttaaaattgctccggccgccattacctgataaaaatcaataattttgacgataaaaataatgttttaagggtagggaaaactgagaaacagagttaagtcattcatcatatcacaataaatcgaaaaacacgattgaaacacaaagaacgtggtgaattt