Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T01H8.5   

sjj_T01H8.5 RNAi JA:T01H8.5
Simmer:T01H8.5:Screen_A
Simmer:T01H8.5:Screen_B
PCR_productsjj_T01H8.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST01H8.5 Source_evidenceePCR709WS150 Sequence/Annotation Release
Overlaps_Gene T01H8.5 Source_evidenceePCR709WS150 Sequence/Annotation Release
Chunk_score Abs_score627
Max_abs_score627T01H8.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI85571858558053
Overlaps_transcriptT01H8.5 Source_evidenceePCR709WS150 Sequence/Annotation Release
WB_DNA_textsjj_T01H8.5869ttccttacccatcttcggtgacattttgatgtgcaaacgcgagaagatcagcagctcttccacttccatcacaaaccacaacaggaacacgtggaacattcgtgacgtaatcgagaactgatcgaattgtacaacttccaccttcaagcacaacacaaacgactggaacacttcgagttcctccaaatattttttgtttttgggaaatgtacatttcgagtctcttacgaagaattacttctgctccgtacctgaaataagctttgaaatcttaagaaacaacaggaacctaccttccaacagttccattatcaactaacaagaaatacgaatgtctgttattgagtcctgtgaatcttcctttcgatgaactcggataatatgggacagttttatcttgtccaataaagtcctctcgtttcttcagcaatccccacggagcaattccaatacacacaatcttatttctttgagcagattgagcaccttcaagggcagcagccacatgtttcactacacccgtgtcacatccacttgtgataatccatgctcctgttgtagacgccgctttcagaagacctttccgaaagactcgtgctagttttggttgaagactgaaattcgttttagaaatgtagaagagaaatgtcaagctcactcaaaattgcttgttcctccgtgaacagtgatgataagtctcggcggtgaaatctgccaaacgtgctcaaacaaagacataatgtatgctggctctgtgtcaaagttgactcgaacatattgagctttgtatggatgtggtccacctgtacagaattatttgtttcaaatgaatacctcattagttaaaaacaggggtaaacaggcgatta