Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_T02E1.3_b   

sjj_T02E1.3_bSequenceACTGAATTGGGTGAGAAATGAGA
PCR_productsjj_T02E1.3