Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T02E1.4   

sjj_T02E1.4RNAiJA:T02E1.4
PCR_productsjj_T02E1.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST02E1.4 Source_evidenceePCR318WS150 Sequence/Annotation Release
Overlaps_Gene T02E1.3 Source_evidenceePCR185WS150 Sequence/Annotation Release
Chunk_score (3)
Map_statusTop50_percentile_ePCRI82177938218639
T02E1.4 Source_evidenceePCR318WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusBest_ePCRI82177938218639
Overlaps_transcript T02E1.3a Source_evidenceePCR185WS150 Sequence/Annotation Release
T02E1.4 Source_evidenceePCR318WS150 Sequence/Annotation Release
WB_DNA_textsjj_T02E1.4847ggataccatccacaaaagtacgatattcataatttaaattttgtatttttcttcactttttgttccatttacacttgttttcattatttctaacgagcccgcgccgctcttgacactagctttgtaatagtaatagttagctgtagttgtagtaagttttagcgaacattcatctaataaatctataaatgtgaaaaatgttgcaagtccaaacctcaactcccatcgcttccaattctttgagtgtttctttgtttccttgctcgtttatatcccataacactaatcttgcaccgagttttccgaactcgaaggccatcaatcggcctaatccacttccggagccagtgatcagcacagtttgtcctgaaacttttaatattatttccttgtgtacgtgatccgatacctcgaacgtcttttcgtagtagccatcccattgggaagcaatttctaattgtggagataataagaagacatatggcatgtagagtcaccacaacactttctagaatatcctgcatctacaaaatcggaaaattgagggaatttttaaaccaaaaattaaaacgtattggttttcttgaaaagtttctggaaaaaagctagaatacaaaaaaaaagaatcaagattgagaaatcatataatgaagagtttttgttgactgtacacgctttttctcttatcattcaacattttatcagtgaatagaccatgttctgtaaacattttgataagagatggagaaatagtgttggaaatgaagagaattagatagaaggtagagtggagccgagaatacagaattttgaagtttttgattcatagttttggtcgaagaaatgc