Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T02G6.5   

sjj_T02G6.5RNAiJA:T02G6.5
PCR_productsjj_T02G6.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST02G6.5 Source_evidenceePCR875WS150 Sequence/Annotation Release
Overlaps_Gene T02G6.5 Source_evidenceePCR875WS150 Sequence/Annotation Release
Chunk_score Abs_score791
Max_abs_score791T02G6.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1181782911819006
Overlaps_transcriptT02G6.5 Source_evidenceePCR875WS150 Sequence/Annotation Release
WB_DNA_textsjj_T02G6.51178ccggcatatcgcaaaatagttctacaaatggatatttgtgacatgtaaatttttacctagaatatttccatttaaaaaatgtaactttttcaggttacagctgtctagaacttcctccaacacctgtctgaaaacgaaaaaagtgaatcggaagatttataagctgatgatttcggacccgaaacttcatgacaataatcttatcactgaagatcccttacgtcaagtttatgttatcgaatcaaaagctgacttggacttcatatacagctcgataaaaagggtgtatggaaagaacgaagggatgttttcatctgcaaattttaactattggattcgaacgttttggtaaattttttggcaattaagggccggctctgcctaggtctaactaagtctaactagatctgactaggtgtatcttggtctggctaggactgactatatccggctaggttttactcaatcctactaggtccgattagaatattttgtaaaaataattaaattttccagtgaacatcaaaaagagcaagaaaagttccgcagcattccctacgccaattctgaagagcttcatcatttgttgaactttatcaatcaatcggtcatagtggatgagctggatttattgattcaccacaactctctatttggagattataagtcaattttgagtcatcaaatgttggataactgtcatgatgtggagattttcggacctgatttttccctccgtaatgatgaagtgaatatcttgttggatagaatcaatttaagcggaaaactatcgattgaatgcatgttcagttcaagtttcaataaggaaatcgtaagtttttaaggctaaatttaatcgtagtcactttaattcattttcagctattcaacattccccaattagaaatctggaatgctttgagcttcaccctccaagacgtgatgaacatgaactgtgaagtgataattctgcaacatcatatcctcaagtcattggatatcaatcgtttgattcattattggttagccgggaagatgccgaatttgagaagaatccgagtcaacgccaatcctgatgcaaaaatgttaaggggaattgtgaattatgcttggcacccaagaagacgtccacaagtttttaggtgagattttgtttttaaggttgactaggcctggct