Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T03A1.4   

sjj_T03A1.4RNAiJA:T03A1.4
PCR_productsjj_T03A1.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK973.6 Source_evidenceePCR763WS150 Sequence/Annotation Release
Overlaps_Gene ZK973.6 Source_evidenceePCR763WS150 Sequence/Annotation Release
Chunk_score Abs_score705
Max_abs_score705ZK973.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI43251724326312
Overlaps_transcriptZK973.6 Source_evidenceePCR763WS150 Sequence/Annotation Release
WB_DNA_textsjj_T03A1.41141tttggctcatcagcatcttggtgtcagacggcttttggctgttgaagatatgatgatcgaaaaaccggacaaaagatcagttattacttatgtgtcacagtttgttcgaatgttcggagaaagatcaccaatgcaaggaagagagcaacatgaaatcttcttggcttggcttgaggctacctatcttctatgcacaagacatgagctcaattcgcaggtaacttaatttttatgtttttgcaatttattttccaaggaggaagtagtaaaattggaaattttggataagtgggaaaaaaccagcaaaaaggactgcatttttcaaagataaaccacttttttcttctaaaaattttggtaaattcctgtttattaagataattatttcctgacaatacctgtgccttgccctgcaaaaaacttcaaacatgactcttgtttccaggaatgctcacgtattcgtcgtgaattcattgagcatcgtccactgttcaacacaattattgttacaaaagtcaattatgatgttgaagaattagtggaaattgagaagaaatgggattgcatccgtgaaacgctcgaaaagtatgctcgccgctcagaacgagatcttccagaaccattcgcatcaatcgccacgtggatcgccggagccgagcatattctatcgagaccgctggatcttgatgctactgatgcaaagaagacagtcacgatgcttcaaaagctgataagtgaacatcaaaagtatatggaagacttaccaaagcgacaagaagactttgaagaagctgtgaaacacggtggactcggaggtcgaccagttgctccggaattcagtgagcctctgagagcaagatttgcacaaatcgaagaggagaatgaaccgcgcatttcaacactgcgcattttgactacacactatattctcctgcaatatttgcaacatattgatgagaaaatcattctttggaggtgagcgtttgggaatttattttgtgaattccttgattttgggtctcatcgcgactaattttgccacatatttgaaatatatatttttcaataaaaaactactaattgatataatacctatttaactgtctaatttaaacaaaattccagaacggctgacagtgta