Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T03D3.8   

sjj_T03D3.8 RNAi JA:T03D3.8
Simmer:T03D3.8:Repeat_a
Simmer:T03D3.8:Repeat_b
Simmer:T03D3.8:Screen
PCR_productsjj_T03D3.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T03D3.9 Chunk_score Abs_score117
Specificity_index0.122
Rel_score0.139
T03D3.8 Chunk_score Abs_score843
Max_abs_score843T03D3.8
Specificity_index0.878
Rel_score1
Overlaps_pseudogene T03D3.8 Source_evidenceePCR874WS150 Sequence/Annotation Release
Map_statusUnique_ePCRV28390972840295
WB_DNA_textsjj_T03D3.81199cgaaggaaaacactcccaaagcgatggattcgaaataattgaacgatctgaaaataagaggattaagttgaacaatttctcagcgcctacttgttcagttgtataccaaaaattgggctataccaacacagtagacacggcgaaaaactgatgaagattggaatgactgtttgtacaattagagctctgaggagctcaaattgaagtcgtgaagttttttggcttgttctcactgacattgtcttgagcttttgcattatctgaaccatgtaccagttgttcttttttatccaaaaattatttaccaatcgagccatcacaaaaaatgatgtgatagatacaatggatattgttgacaaacttgttatgagttcccatgcccgtagagtcgttttgtcagatccaacctaaagcattaaagtcatgatttttaataaaacaaatggattacgctgaacatcgatcccatcatgttcaaattcgttgaatctattccgaaattttcttgaaaatccacacgaatatattggagaagctccgaatttgccttgcctgggaaataacacgtggcgtaccacaaagaataataaaccaaacacaataaaaacgatccagtcatgtgggaagtgatgtcttgttagacttgaatcgagaattacaagatatcgatatatgaaatgacttaataagactgcatagctagatcctataaatgagcagcgagcagtgagcatatggtaattaaactcagagctgcttgtttggaaccaaccgtatctgacaaacaccacagatgagtagcggtagttgtggatttcctggaactttattgctttaagttgtaatattgtaaaacctaccagcggaaccaaaacattcatcattgagtaaatcatgttgaaaactgcaaaacacaaaagcaagtatcgataattaccaaaaactgccgacttttctgagacaatcaaatgtataaatatcggattcactagaaaagctaaggcacaaaaagttgatgacaaatataaacaaatccagtcgtcaaacattatggggaaattatgtattgatgaaactggcaaaaggaagtatttgaatcgcagttcacaattggtgggcgtattctaataccaattatatacgtttagtcgtattcggaacattttagaaacccgaatcccaggacaaggcaaaatgat