Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T03D8.5   

sjj_T03D8.5RNAiJA:T03D8.5
PCR_productsjj_T03D8.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST03D8.5 Source_evidenceePCR984WS150 Sequence/Annotation Release
Overlaps_Gene T03D8.5 Source_evidenceePCR984WS150 Sequence/Annotation Release
Chunk_score Abs_score921
Max_abs_score921T03D8.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV2081917220820354
Overlaps_transcriptT03D8.5 Source_evidenceePCR984WS150 Sequence/Annotation Release
WB_DNA_textsjj_T03D8.51183tttaccgaaatttgccgaacggcaattgccgcccacctcagatacaaaccttgtaaacgtcatgttgttcaatgattgcatcgaaagttgtgtacaagtcattcaaaagattaactacttgaagtggagtgcatcttgaggctaatgtcgtaaatgatacgacatcggaaaagaagatggtgacacagtcaaatgtttcaggttctactgattgcccaagtttcaatttttcagccacttgtctgaagtttagatttgatgaatctaaacttataaaagcgacttacttaggcaacattctgtatagtaaaacgtcacttcgctttttctcttcagtcaattctttcatccgggcttgaacctgaaattgcacactgtgaaagtgcacttgaaagcggatgaaaatacctcatcctccaaattagatgcatattgttccagtacattgaaaacgtgatccatcaaattagacgaacggttatgattcatactcttcattaaagtcttgatttgttcacttgttggccgttgatcaggattttcgttccagcaatctctaaccagtaacgacatgcttccattgtgttcatcttcagtttccaaggatggtcttggagggcttctgcctccttttttaattttataaaccaactcctcaatatcgaatgtttcgttctcaagatcccaagcgcttttcttagttatcagttcagaacaaattatcgcgaatgagtagatatccatttcttttgtgataggtaaattcgtatctctaatgtgctctggtgccgtatgtagaaaatctctttgttctttcacttcatactgtttgattgcggacaatccaaagaaactgacttttacctacaaattctatgattagtatggttataaccgttcaatttttaagaggatgccaacctgccatctttcatcaactaaacatgtagaagagctcaaccagccatggggtccaattggagagtgatgaaggtaatagatagcatctgcgacgtcacgcattagagaatatttgaaaaaccaatccatttgaagtgagcccttagctataacatcttgaagtgatcctcttgaacaatatctccaaatggaaatcaaagttggtgagtcaagagataacccgatgaatttacacaagttgtcattgtccacatttcgcatc